EMAIL THIS PAGE TO A FRIEND

ZFAT

zinc finger and AT hook domain containing

Synonyms: AITD3 ZFAT1 ZNF406
Gene ID:
Human(57623) Summary: This gene encodes a protein that likely binds DNA and functions as a transcriptional regulator involved in apoptosis and cell survival. This gene resides in a susceptibility locus for autoimmune thyroid disease (AITD) on chromosome 8q24. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
Mouse(380993) zinc finger and AT hook domain containing
Rat(362925) zinc finger and AT hook domain containing
Zebrafish(566334) zinc finger and AT hook domain containing
Horse(100069060) zinc finger and AT hook domain containing
domestic cat(101089580) zinc finger and AT hook domain containing
chicken(420319) zinc finger and AT hook domain containing
dog(482051) zinc finger and AT hook domain containing
naked mole-rat(101717705) zinc finger and AT hook domain containing
domestic guinea pig(100728508) zinc finger and AT hook domain containing
cow(522282) zinc finger and AT hook domain containing
sheep(101119913) zinc finger and AT hook domain containing
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020863 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021491 MISSION® esiRNA esiRNA human ZFAT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029939 Rosetta Predictions human pricing
NM_020863 Rosetta Predictions human pricing
NM_001134957 Rosetta Predictions rat pricing
XM_001068250 Rosetta Predictions rat pricing
NM_198644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240736 predicted 520
2 SASI_Hs01_00240737 predicted 1270
3 SASI_Hs01_00240738 predicted 501
4 SASI_Hs01_00240739 predicted 721
5 SASI_Hs01_00240740 predicted 1563
6 SASI_Hs01_00240741 predicted 544
7 SASI_Hs01_00240742 predicted 2269
8 SASI_Hs01_00240743 predicted 2236
9 SASI_Hs01_00240744 predicted 720
10 SASI_Hs01_00240745 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010881 predicted 593
2 SASI_Hs01_00010882 predicted 1347
3 SASI_Hs01_00010883 predicted 574
4 SASI_Hs01_00010884 predicted 792
5 SASI_Hs01_00010885 predicted 1634
6 SASI_Hs01_00010886 predicted 621
7 SASI_Hs01_00010887 predicted 2341
8 SASI_Hs01_00010888 predicted 2314
9 SASI_Hs01_00010889 predicted 794
10 SASI_Hs01_00010890 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259074 predicted 3020
2 SASI_Rn02_00259075 predicted 1712
3 SASI_Rn02_00259076 predicted 3914
4 SASI_Rn02_00259077 predicted 1306
5 SASI_Rn02_00259078 predicted 1037
6 SASI_Rn02_00259079 predicted 944
7 SASI_Rn02_00259080 predicted 3123
8 SASI_Rn02_00259081 predicted 2498
9 SASI_Rn02_00259082 predicted 1382
10 SASI_Rn02_00259083 predicted 2617
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323957 predicted 3021
2 SASI_Rn02_00323958 predicted 1713
3 SASI_Rn02_00323959 predicted 3918
4 SASI_Rn02_00323960 predicted 1306
5 SASI_Rn02_00323961 predicted 1037
6 SASI_Rn02_00323962 predicted 944
7 SASI_Rn02_00323963 predicted 3127
8 SASI_Rn02_00323964 predicted 2495
9 SASI_Rn02_00323965 predicted 1386
10 SASI_Rn02_00323966 predicted 2612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126433 predicted 3010
2 SASI_Mm01_00126434 predicted 1023
3 SASI_Mm02_00351112 predicted 2442
4 SASI_Mm01_00126436 predicted 1603
5 SASI_Mm01_00126438 predicted 3284
6 SASI_Mm01_00126439 predicted 1314
7 SASI_Mm02_00351113 predicted 2311
8 SASI_Mm01_00126440 predicted 2600
9 SASI_Mm01_00126441 predicted 895
10 SASI_Mm02_00351114 predicted 764
11 SASI_Mm01_00126435 predicted 1705
12 SASI_Mm01_00126437 predicted 2491
13 SASI_Mm01_00126442 predicted 2505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198644
ZFAT MISSION shRNA Bacterial Glycerol Stock
zinc finger and AT hook domain containing
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198644.2-2768s21c1
Sequence:CCGGAGCCATGAAGTGTCCATATTGCTCGAGCAATATGGACACTTCATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198644.2-2551s21c1
Sequence:CCGGACTACTCGACTCCAGATAAATCTCGAGATTTATCTGGAGTCGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198644.2-2740s21c1
Sequence:CCGGTCCAGCTCAAAGGGCTAATTGCTCGAGCAATTAGCCCTTTGAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198644.1-3908s1c1
Sequence:CCGGGCCCAGATAGAGTTCTCTGTACTCGAGTACAGAGAACTCTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198644.1-2651s1c1
Sequence:CCGGCCGATTGATAAAGTCACATATCTCGAGATATGTGACTTTATCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198644.1-2440s1c1
Sequence:CCGGGCTCCCAGTGTCACTATTCTTCTCGAGAAGAATAGTGACACTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198644.1-1371s1c1
Sequence:CCGGCGCAAGTTCAAGAATGAGCTACTCGAGTAGCTCATTCTTGAACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198644.1-389s1c1
Sequence:CCGGGCCTAAGGGTTCCACAAAGAACTCGAGTTCTTTGTGGAACCCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198644
ZFAT MISSION shRNA shRNA Plasmid DNA
zinc finger and AT hook domain containing
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198644.2-2768s21c1
Sequence:CCGGAGCCATGAAGTGTCCATATTGCTCGAGCAATATGGACACTTCATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198644.2-2551s21c1
Sequence:CCGGACTACTCGACTCCAGATAAATCTCGAGATTTATCTGGAGTCGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198644.2-2740s21c1
Sequence:CCGGTCCAGCTCAAAGGGCTAATTGCTCGAGCAATTAGCCCTTTGAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198644.1-3908s1c1
Sequence:CCGGGCCCAGATAGAGTTCTCTGTACTCGAGTACAGAGAACTCTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198644.1-2651s1c1
Sequence:CCGGCCGATTGATAAAGTCACATATCTCGAGATATGTGACTTTATCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198644.1-2440s1c1
Sequence:CCGGGCTCCCAGTGTCACTATTCTTCTCGAGAAGAATAGTGACACTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198644.1-1371s1c1
Sequence:CCGGCGCAAGTTCAAGAATGAGCTACTCGAGTAGCTCATTCTTGAACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198644.1-389s1c1
Sequence:CCGGGCCTAAGGGTTCCACAAAGAACTCGAGTTCTTTGTGGAACCCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198644
ZFAT MISSION shRNA Lentiviral Transduction Particles
zinc finger and AT hook domain containing
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198644.2-2768s21c1
Sequence:CCGGAGCCATGAAGTGTCCATATTGCTCGAGCAATATGGACACTTCATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198644.2-2551s21c1
Sequence:CCGGACTACTCGACTCCAGATAAATCTCGAGATTTATCTGGAGTCGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198644.2-2740s21c1
Sequence:CCGGTCCAGCTCAAAGGGCTAATTGCTCGAGCAATTAGCCCTTTGAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198644.1-3908s1c1
Sequence:CCGGGCCCAGATAGAGTTCTCTGTACTCGAGTACAGAGAACTCTATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198644.1-2651s1c1
Sequence:CCGGCCGATTGATAAAGTCACATATCTCGAGATATGTGACTTTATCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198644.1-2440s1c1
Sequence:CCGGGCTCCCAGTGTCACTATTCTTCTCGAGAAGAATAGTGACACTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198644.1-1371s1c1
Sequence:CCGGCGCAAGTTCAAGAATGAGCTACTCGAGTAGCTCATTCTTGAACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198644.1-389s1c1
Sequence:CCGGGCCTAAGGGTTCCACAAAGAACTCGAGTTCTTTGTGGAACCCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020863
ZFAT MISSION shRNA Bacterial Glycerol Stock
zinc finger and AT hook domain containing
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020863.2-1003s1c1
Sequence:CCGGCAACAAGGTCTTCAAGTTCAACTCGAGTTGAACTTGAAGACCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020863.2-2535s1c1
Sequence:CCGGGCCACGTAATTCAGAAACACACTCGAGTGTGTTTCTGAATTACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020863.2-577s1c1
Sequence:CCGGCATCTGCATTATCGTGCTGAACTCGAGTTCAGCACGATAATGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020863.2-988s1c1
Sequence:CCGGCACTTGTGAATACTGCAACAACTCGAGTTGTTGCAGTATTCACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020863.2-4450s1c1
Sequence:CCGGCCTTGGTATCAAGTGAGGTAACTCGAGTTACCTCACTTGATACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020863.2-3327s1c1
Sequence:CCGGGCACCAAATGGGAGTTCAATACTCGAGTATTGAACTCCCATTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020863.2-917s1c1
Sequence:CCGGGCCATTCAGCAGACACCTTATCTCGAGATAAGGTGTCTGCTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020863.2-1219s1c1
Sequence:CCGGGCACAAGAAGATCAAGCAGCACTCGAGTGCTGCTTGATCTTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020863
ZFAT MISSION shRNA shRNA Plasmid DNA
zinc finger and AT hook domain containing
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020863.2-1003s1c1
Sequence:CCGGCAACAAGGTCTTCAAGTTCAACTCGAGTTGAACTTGAAGACCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020863.2-2535s1c1
Sequence:CCGGGCCACGTAATTCAGAAACACACTCGAGTGTGTTTCTGAATTACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020863.2-577s1c1
Sequence:CCGGCATCTGCATTATCGTGCTGAACTCGAGTTCAGCACGATAATGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020863.2-988s1c1
Sequence:CCGGCACTTGTGAATACTGCAACAACTCGAGTTGTTGCAGTATTCACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020863.2-4450s1c1
Sequence:CCGGCCTTGGTATCAAGTGAGGTAACTCGAGTTACCTCACTTGATACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020863.2-3327s1c1
Sequence:CCGGGCACCAAATGGGAGTTCAATACTCGAGTATTGAACTCCCATTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020863.2-917s1c1
Sequence:CCGGGCCATTCAGCAGACACCTTATCTCGAGATAAGGTGTCTGCTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020863.2-1219s1c1
Sequence:CCGGGCACAAGAAGATCAAGCAGCACTCGAGTGCTGCTTGATCTTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020863
ZFAT MISSION shRNA Lentiviral Transduction Particles
zinc finger and AT hook domain containing
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020863.2-1003s1c1
Sequence:CCGGCAACAAGGTCTTCAAGTTCAACTCGAGTTGAACTTGAAGACCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020863.2-2535s1c1
Sequence:CCGGGCCACGTAATTCAGAAACACACTCGAGTGTGTTTCTGAATTACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020863.2-577s1c1
Sequence:CCGGCATCTGCATTATCGTGCTGAACTCGAGTTCAGCACGATAATGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020863.2-988s1c1
Sequence:CCGGCACTTGTGAATACTGCAACAACTCGAGTTGTTGCAGTATTCACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020863.2-4450s1c1
Sequence:CCGGCCTTGGTATCAAGTGAGGTAACTCGAGTTACCTCACTTGATACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020863.2-3327s1c1
Sequence:CCGGGCACCAAATGGGAGTTCAATACTCGAGTATTGAACTCCCATTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020863.2-917s1c1
Sequence:CCGGGCCATTCAGCAGACACCTTATCTCGAGATAAGGTGTCTGCTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020863.2-1219s1c1
Sequence:CCGGGCACAAGAAGATCAAGCAGCACTCGAGTGCTGCTTGATCTTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks