EMAIL THIS PAGE TO A FRIEND

ZFC3H1

zinc finger, C3H1-type containing

Synonyms: CCDC131 PSRC2
UniProtKB ID: O60293, Q6GMU1, Q6P2S9, Q6ZV36, Q96BE7
Gene ID:
Mouse(216345) zinc finger, C3H1-type containing
Rat(314836) zinc finger, C3H1-type containing
chicken(417855) zinc finger, C3H1-type containing
dog(474449) zinc finger, C3H1-type containing
Horse(100064600) zinc finger, C3H1-type containing
domestic cat(101080979) zinc finger, C3H1-type containing
cow(781886) zinc finger, C3H1-type containing
sheep(101119547) zinc finger, C3H1-type containing
domestic guinea pig(100719160) zinc finger, C3H1-type containing
naked mole-rat(101717164) zinc finger, C3H1-type containing
142 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144982 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033261 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033261 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033261 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144982 Rosetta Predictions human pricing
XM_001078674 Rosetta Predictions rat pricing
XM_001078700 Rosetta Predictions rat pricing
XM_235146 Rosetta Predictions rat pricing
NM_001033261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120222 predicted 5536
2 SASI_Hs01_00120223 predicted 2861
3 SASI_Hs01_00120224 predicted 3969
4 SASI_Hs02_00364789 predicted 1293
5 SASI_Hs02_00364790 predicted 2464
6 SASI_Hs01_00120226 predicted 5846
7 SASI_Hs01_00120228 predicted 3878
8 SASI_Hs01_00120229 predicted 6119
9 SASI_Hs02_00364791 predicted 2350
10 SASI_Hs01_00120230 predicted 2549
11 SASI_Hs01_00120225 predicted 2292
12 SASI_Hs01_00120227 predicted 5589
13 SASI_Hs01_00120231 predicted 5705
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361647 predicted 3069
2 SASI_Rn02_00361648 predicted 5457
3 SASI_Rn02_00361649 predicted 2668
4 SASI_Rn02_00361650 predicted 4494
5 SASI_Rn02_00361651 predicted 4869
6 SASI_Rn02_00361652 predicted 3799
7 SASI_Rn02_00361653 predicted 4585
8 SASI_Rn02_00361654 predicted 2811
9 SASI_Rn02_00361655 predicted 4435
10 SASI_Rn02_00361656 predicted 2240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361768 predicted 3077
2 SASI_Rn02_00361769 predicted 2666
3 SASI_Rn02_00361770 predicted 4867
4 SASI_Rn02_00361771 predicted 3796
5 SASI_Rn02_00361772 predicted 4584
6 SASI_Rn02_00361773 predicted 5725
7 SASI_Rn02_00361774 predicted 2811
8 SASI_Rn02_00361775 predicted 4433
9 SASI_Rn02_00361776 predicted 2235
10 SASI_Rn02_00361777 predicted 5738
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389025 predicted 2663
2 SASI_Rn02_00389026 predicted 4302
3 SASI_Rn02_00389027 predicted 4677
4 SASI_Rn02_00389028 predicted 3607
5 SASI_Rn02_00389029 predicted 4391
6 SASI_Rn02_00389030 predicted 5539
7 SASI_Rn02_00389031 predicted 2798
8 SASI_Rn02_00389032 predicted 4236
9 SASI_Rn02_00389033 predicted 2228
10 SASI_Rn02_00389034 predicted 5546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102348 predicted 1044
2 SASI_Mm01_00102349 predicted 3429
3 SASI_Mm01_00102350 predicted 2679
4 SASI_Mm01_00102351 predicted 4878
5 SASI_Mm01_00102352 predicted 5327
6 SASI_Mm01_00102353 predicted 957
7 SASI_Mm01_00102354 predicted 3377
8 SASI_Mm01_00102355 predicted 5737
9 SASI_Mm01_00102356 predicted 6155
10 SASI_Mm02_00288435 predicted 4764
11 SASI_Mm01_00102347 predicted 3751
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144982
VALIDATED
ZFC3H1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, C3H1-type containing
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144982.3-4488s1c1
Sequence:CCGGGCTGTTGAATATGCTCCAGATCTCGAGATCTGGAGCATATTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_144982.3-2204s1c1
Sequence:CCGGGCCAAGAAGCAATCTATCAATCTCGAGATTGATAGATTGCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129791    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144982.3-5998s1c1
Sequence:CCGGCCAGACAGGTAAATCTGAAATCTCGAGATTTCAGATTTACCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144982.3-1521s1c1
Sequence:CCGGGCATGGAAGAAACTACAACAACTCGAGTTGTTGTAGTTTCTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144982.3-5829s1c1
Sequence:CCGGGCATTGAGGTTACTTCAACATCTCGAGATGTTGAAGTAACCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144982.3-5288s1c1
Sequence:CCGGGCGGAAATTTATTGCATCCTTCTCGAGAAGGATGCAATAAATTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-4388s21c1
Sequence:CCGGGACTGATGACATCGCTAATTTCTCGAGAAATTAGCGATGTCATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144982.4-6424s21c1
Sequence:CCGGGTAAGGCAGACAAGCGTTATTCTCGAGAATAACGCTTGTCTGCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-6262s21c1
Sequence:CCGGAGATTGGAGTCAGCCTAAATGCTCGAGCATTTAGGCTGACTCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-2240s21c1
Sequence:CCGGGCTTCGAGAAGAACTACTTAACTCGAGTTAAGTAGTTCTTCTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-5530s21c1
Sequence:CCGGTTGACATTCCATCTCGTTTATCTCGAGATAAACGAGATGGAATGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144982.4-6557s21c1
Sequence:CCGGGATTCTCATAACATCATATACCTCGAGGTATATGATGTTATGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-1908s21c1
Sequence:CCGGGATAGTGGAGGAGGCATTTATCTCGAGATAAATGCCTCCTCCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144982.4-6448s21c1
Sequence:CCGGCATATCAAGTTCCCTACAATACTCGAGTATTGTAGGGAACTTGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144982
VALIDATED
ZFC3H1 MISSION shRNA shRNA Plasmid DNA
zinc finger, C3H1-type containing
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144982.3-4488s1c1
Sequence:CCGGGCTGTTGAATATGCTCCAGATCTCGAGATCTGGAGCATATTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_144982.3-2204s1c1
Sequence:CCGGGCCAAGAAGCAATCTATCAATCTCGAGATTGATAGATTGCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129791    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144982.3-5998s1c1
Sequence:CCGGCCAGACAGGTAAATCTGAAATCTCGAGATTTCAGATTTACCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144982.3-1521s1c1
Sequence:CCGGGCATGGAAGAAACTACAACAACTCGAGTTGTTGTAGTTTCTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144982.3-5829s1c1
Sequence:CCGGGCATTGAGGTTACTTCAACATCTCGAGATGTTGAAGTAACCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144982.3-5288s1c1
Sequence:CCGGGCGGAAATTTATTGCATCCTTCTCGAGAAGGATGCAATAAATTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-4388s21c1
Sequence:CCGGGACTGATGACATCGCTAATTTCTCGAGAAATTAGCGATGTCATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144982.4-6424s21c1
Sequence:CCGGGTAAGGCAGACAAGCGTTATTCTCGAGAATAACGCTTGTCTGCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-6262s21c1
Sequence:CCGGAGATTGGAGTCAGCCTAAATGCTCGAGCATTTAGGCTGACTCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-2240s21c1
Sequence:CCGGGCTTCGAGAAGAACTACTTAACTCGAGTTAAGTAGTTCTTCTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-5530s21c1
Sequence:CCGGTTGACATTCCATCTCGTTTATCTCGAGATAAACGAGATGGAATGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144982.4-6557s21c1
Sequence:CCGGGATTCTCATAACATCATATACCTCGAGGTATATGATGTTATGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-1908s21c1
Sequence:CCGGGATAGTGGAGGAGGCATTTATCTCGAGATAAATGCCTCCTCCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144982.4-6448s21c1
Sequence:CCGGCATATCAAGTTCCCTACAATACTCGAGTATTGTAGGGAACTTGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144982
VALIDATED
ZFC3H1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, C3H1-type containing
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144982.3-4488s1c1
Sequence:CCGGGCTGTTGAATATGCTCCAGATCTCGAGATCTGGAGCATATTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_144982.3-2204s1c1
Sequence:CCGGGCCAAGAAGCAATCTATCAATCTCGAGATTGATAGATTGCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129791    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144982.3-5998s1c1
Sequence:CCGGCCAGACAGGTAAATCTGAAATCTCGAGATTTCAGATTTACCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144982.3-1521s1c1
Sequence:CCGGGCATGGAAGAAACTACAACAACTCGAGTTGTTGTAGTTTCTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144982.3-5829s1c1
Sequence:CCGGGCATTGAGGTTACTTCAACATCTCGAGATGTTGAAGTAACCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144982.3-5288s1c1
Sequence:CCGGGCGGAAATTTATTGCATCCTTCTCGAGAAGGATGCAATAAATTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-4388s21c1
Sequence:CCGGGACTGATGACATCGCTAATTTCTCGAGAAATTAGCGATGTCATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144982.4-6424s21c1
Sequence:CCGGGTAAGGCAGACAAGCGTTATTCTCGAGAATAACGCTTGTCTGCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-6262s21c1
Sequence:CCGGAGATTGGAGTCAGCCTAAATGCTCGAGCATTTAGGCTGACTCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-2240s21c1
Sequence:CCGGGCTTCGAGAAGAACTACTTAACTCGAGTTAAGTAGTTCTTCTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-5530s21c1
Sequence:CCGGTTGACATTCCATCTCGTTTATCTCGAGATAAACGAGATGGAATGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144982.4-6557s21c1
Sequence:CCGGGATTCTCATAACATCATATACCTCGAGGTATATGATGTTATGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144982.4-1908s21c1
Sequence:CCGGGATAGTGGAGGAGGCATTTATCTCGAGATAAATGCCTCCTCCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144982.4-6448s21c1
Sequence:CCGGCATATCAAGTTCCCTACAATACTCGAGTATTGTAGGGAACTTGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033261
ZFC3H1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, C3H1-type containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033261.2-6151s21c1
Sequence:CCGGAGATTGGAGTCAGCCTAAATGCTCGAGCATTTAGGCTGACTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033261.2-1064s21c1
Sequence:CCGGCACCGATAATGCTAGTATTACCTCGAGGTAATACTAGCATTATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033261.2-6485s21c1
Sequence:CCGGCAAAGCGACTGACGTTTATTTCTCGAGAAATAAACGTCAGTCGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033261.2-1797s21c1
Sequence:CCGGGACAGTGCAGGAGGCATATATCTCGAGATATATGCCTCCTGCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033261.2-5245s21c1
Sequence:CCGGACCCTCAGAATGCGGAAATTTCTCGAGAAATTTCCGCATTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033261
ZFC3H1 MISSION shRNA shRNA Plasmid DNA
zinc finger, C3H1-type containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033261.2-6151s21c1
Sequence:CCGGAGATTGGAGTCAGCCTAAATGCTCGAGCATTTAGGCTGACTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033261.2-1064s21c1
Sequence:CCGGCACCGATAATGCTAGTATTACCTCGAGGTAATACTAGCATTATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033261.2-6485s21c1
Sequence:CCGGCAAAGCGACTGACGTTTATTTCTCGAGAAATAAACGTCAGTCGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033261.2-1797s21c1
Sequence:CCGGGACAGTGCAGGAGGCATATATCTCGAGATATATGCCTCCTGCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033261.2-5245s21c1
Sequence:CCGGACCCTCAGAATGCGGAAATTTCTCGAGAAATTTCCGCATTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033261
ZFC3H1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, C3H1-type containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033261.2-6151s21c1
Sequence:CCGGAGATTGGAGTCAGCCTAAATGCTCGAGCATTTAGGCTGACTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033261.2-1064s21c1
Sequence:CCGGCACCGATAATGCTAGTATTACCTCGAGGTAATACTAGCATTATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033261.2-6485s21c1
Sequence:CCGGCAAAGCGACTGACGTTTATTTCTCGAGAAATAAACGTCAGTCGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033261.2-1797s21c1
Sequence:CCGGGACAGTGCAGGAGGCATATATCTCGAGATATATGCCTCCTGCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033261.2-5245s21c1
Sequence:CCGGACCCTCAGAATGCGGAAATTTCTCGAGAAATTTCCGCATTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks