EMAIL THIS PAGE TO A FRIEND

ZFHX2

zinc finger homeobox 2

Synonyms: ZFH-5 ZNF409
UniProtKB ID: Q9C0A1, Q9UPU6
Gene ID:
Mouse(239102) zinc finger homeobox 2
Rat(305888) zinc finger homeobox 2
Horse(100052278) zinc finger homeobox 2
dog(490613) zinc finger homeobox 2
domestic cat(101096990) zinc finger homeobox 2
naked mole-rat(101710533) zinc finger homeobox 2
domestic guinea pig(100726035) zinc finger homeobox 2
cow(539758) zinc finger homeobox 2
sheep(101122193) zinc finger homeobox 2
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_033370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_033370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_033370 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU190991 MISSION® esiRNA esiRNA targeting mouse Zfhx2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033400 Rosetta Predictions human pricing
XM_001714980 Rosetta Predictions human pricing
XM_001720095 Rosetta Predictions human pricing
XM_001722719 Rosetta Predictions human pricing
NM_001098803 Rosetta Predictions rat pricing
XM_001054926 Rosetta Predictions rat pricing
NM_001039198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154714 predicted 3294
2 SASI_Hs01_00154715 predicted 2501
3 SASI_Hs01_00154716 predicted 678
4 SASI_Hs01_00154717 predicted 4490
5 SASI_Hs01_00154718 predicted 3562
6 SASI_Hs01_00154719 predicted 3194
7 SASI_Hs01_00154720 predicted 2482
8 SASI_Hs01_00154721 predicted 657
9 SASI_Hs01_00154722 predicted 1591
10 SASI_Hs01_00154723 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00400679 predicted 7099
2 SASI_Hs02_00400680 predicted 3869
3 SASI_Hs02_00400681 predicted 1980
4 SASI_Hs02_00400682 predicted 1328
5 SASI_Hs02_00400683 predicted 6302
6 SASI_Hs02_00400684 predicted 4477
7 SASI_Hs02_00400685 predicted 1175
8 SASI_Hs02_00400686 predicted 7369
9 SASI_Hs02_00400687 predicted 649
10 SASI_Hs02_00400688 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00434518 predicted 6842
2 SASI_Hs02_00434519 predicted 3620
3 SASI_Hs02_00434520 predicted 1726
4 SASI_Hs02_00434521 predicted 1079
5 SASI_Hs02_00434522 predicted 6051
6 SASI_Hs02_00434523 predicted 4231
7 SASI_Hs02_00434524 predicted 930
8 SASI_Hs02_00434525 predicted 7115
9 SASI_Hs02_00434526 predicted 398
10 SASI_Hs02_00434527 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00450887 predicted 6847
2 SASI_Hs02_00450888 predicted 3622
3 SASI_Hs02_00450889 predicted 1719
4 SASI_Hs02_00450890 predicted 1073
5 SASI_Hs02_00450891 predicted 6050
6 SASI_Hs02_00450892 predicted 4227
7 SASI_Hs02_00450893 predicted 931
8 SASI_Hs02_00450894 predicted 7108
9 SASI_Hs02_00450895 predicted 395
10 SASI_Hs02_00450896 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209191 predicted 7489
2 SASI_Rn02_00209192 predicted 7239
3 SASI_Rn02_00209193 predicted 3281
4 SASI_Rn02_00209194 predicted 2898
5 SASI_Rn02_00209195 predicted 7049
6 SASI_Rn02_00209196 predicted 3859
7 SASI_Rn02_00209197 predicted 7963
8 SASI_Rn02_00209198 predicted 4428
9 SASI_Rn02_00209199 predicted 6419
10 SASI_Rn02_00209200 predicted 4818
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277738 predicted 7491
2 SASI_Rn02_00277739 predicted 7242
3 SASI_Rn02_00277740 predicted 3283
4 SASI_Rn02_00277741 predicted 2902
5 SASI_Rn02_00277742 predicted 7051
6 SASI_Rn02_00277743 predicted 3858
7 SASI_Rn02_00277744 predicted 7967
8 SASI_Rn02_00277745 predicted 4423
9 SASI_Rn02_00277746 predicted 6416
10 SASI_Rn02_00277747 predicted 4819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104339 predicted 6971
2 SASI_Mm01_00104340 predicted 4365
3 SASI_Mm02_00289939 predicted 2669
4 SASI_Mm01_00104341 predicted 6151
5 SASI_Mm01_00104342 predicted 6780
6 SASI_Mm02_00289940 predicted 4147
7 SASI_Mm01_00104343 predicted 5479
8 SASI_Mm01_00104344 predicted 890
9 SASI_Mm01_00104345 predicted 6021
10 SASI_Mm01_00104346 predicted 2997
11 SASI_Mm01_00104347 predicted 3583
12 SASI_Mm01_00104348 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039198
ZFHX2 MISSION shRNA Bacterial Glycerol Stock
zinc finger homeobox 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039198.1-8190s21c1
Sequence:CCGGAGACCGCTCACAAACTCCAAACTCGAGTTTGGAGTTTGTGAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039198.1-8409s21c1
Sequence:CCGGCCCTGGAAACTGCAGTAACTTCTCGAGAAGTTACTGCAGTTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039198.1-8543s21c1
Sequence:CCGGGGCAAATCCAAAGTTCTTTAACTCGAGTTAAAGAACTTTGGATTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039198.1-4626s21c1
Sequence:GTACCGGGTTTCGAAAGAGCTATGATAGCTCGAGCTATCATAGCTCTTTCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039198.1-8437s21c1
Sequence:CCGGTCAAAGGCTTTAAACACAGAGCTCGAGCTCTGTGTTTAAAGCCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039198
ZFHX2 MISSION shRNA shRNA Plasmid DNA
zinc finger homeobox 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039198.1-8190s21c1
Sequence:CCGGAGACCGCTCACAAACTCCAAACTCGAGTTTGGAGTTTGTGAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039198.1-8409s21c1
Sequence:CCGGCCCTGGAAACTGCAGTAACTTCTCGAGAAGTTACTGCAGTTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039198.1-8543s21c1
Sequence:CCGGGGCAAATCCAAAGTTCTTTAACTCGAGTTAAAGAACTTTGGATTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039198.1-4626s21c1
Sequence:GTACCGGGTTTCGAAAGAGCTATGATAGCTCGAGCTATCATAGCTCTTTCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039198.1-8437s21c1
Sequence:CCGGTCAAAGGCTTTAAACACAGAGCTCGAGCTCTGTGTTTAAAGCCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039198
ZFHX2 MISSION shRNA Lentiviral Transduction Particles
zinc finger homeobox 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039198.1-8190s21c1
Sequence:CCGGAGACCGCTCACAAACTCCAAACTCGAGTTTGGAGTTTGTGAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039198.1-8409s21c1
Sequence:CCGGCCCTGGAAACTGCAGTAACTTCTCGAGAAGTTACTGCAGTTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039198.1-8543s21c1
Sequence:CCGGGGCAAATCCAAAGTTCTTTAACTCGAGTTAAAGAACTTTGGATTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039198.1-4626s21c1
Sequence:GTACCGGGTTTCGAAAGAGCTATGATAGCTCGAGCTATCATAGCTCTTTCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039198.1-8437s21c1
Sequence:CCGGTCAAAGGCTTTAAACACAGAGCTCGAGCTCTGTGTTTAAAGCCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_033370
ZFHX2 MISSION shRNA Bacterial Glycerol Stock
zinc finger homeobox 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000016654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033370.9-794s1c1
Sequence:CCGGGCTTCATATCTGGATTGCCTTCTCGAGAAGGCAATCCAGATATGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033370.9-3295s1c1
Sequence:CCGGCCCTATTGTGATGTCAAGTATCTCGAGATACTTGACATCACAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033370.9-1360s1c1
Sequence:CCGGCGCCGCTTTCTGCCCTTTGAACTCGAGTTCAAAGGGCAGAAAGCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033370.9-3963s1c1
Sequence:CCGGCCAACAGCTCTATGGCATGAACTCGAGTTCATGCCATAGAGCTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_033370
ZFHX2 MISSION shRNA shRNA Plasmid DNA
zinc finger homeobox 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000016654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033370.9-794s1c1
Sequence:CCGGGCTTCATATCTGGATTGCCTTCTCGAGAAGGCAATCCAGATATGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033370.9-3295s1c1
Sequence:CCGGCCCTATTGTGATGTCAAGTATCTCGAGATACTTGACATCACAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033370.9-1360s1c1
Sequence:CCGGCGCCGCTTTCTGCCCTTTGAACTCGAGTTCAAAGGGCAGAAAGCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033370.9-3963s1c1
Sequence:CCGGCCAACAGCTCTATGGCATGAACTCGAGTTCATGCCATAGAGCTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_033370
ZFHX2 MISSION shRNA Lentiviral Transduction Particles
zinc finger homeobox 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000016654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033370.9-794s1c1
Sequence:CCGGGCTTCATATCTGGATTGCCTTCTCGAGAAGGCAATCCAGATATGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033370.9-3295s1c1
Sequence:CCGGCCCTATTGTGATGTCAAGTATCTCGAGATACTTGACATCACAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033370.9-1360s1c1
Sequence:CCGGCGCCGCTTTCTGCCCTTTGAACTCGAGTTCAAAGGGCAGAAAGCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033370.9-3963s1c1
Sequence:CCGGCCAACAGCTCTATGGCATGAACTCGAGTTCATGCCATAGAGCTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks