EMAIL THIS PAGE TO A FRIEND

ZFHX3

zinc finger homeobox 3

Synonyms: ATBF1 ATBT ZNF927
UniProtKB ID: Q15911, D3DWS8, O15101, Q13719
Gene ID:
Human(463) Summary: This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(11906) zinc finger homeobox 3
Rat(307829) zinc finger homeobox 3
cow(510844) zinc finger homeobox 3
sheep(101114208) zinc finger homeobox 3
domestic guinea pig(100719701) zinc finger homeobox 3
naked mole-rat(101707787) zinc finger homeobox 3
Zebrafish(100333211) zinc finger homeobox 3
chicken(395682) zinc finger homeobox 3
domestic cat(101099345) zinc finger homeobox 3
Horse(100054244) zinc finger homeobox 3
dog(489729) zinc finger homeobox 3
259 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006885 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006885 Rosetta Predictions human pricing
XM_001076847 Rosetta Predictions rat pricing
XM_226464 Rosetta Predictions rat pricing
NM_007496 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043869 predicted 9702
2 SASI_Hs02_00342544 predicted 10571
3 SASI_Hs01_00043870 predicted 5347
4 SASI_Hs01_00043871 predicted 9081
5 SASI_Hs02_00342545 predicted 7576
6 SASI_Hs02_00342546 predicted 9881
7 SASI_Hs01_00043872 predicted 1360
8 SASI_Hs01_00043873 predicted 9323
9 SASI_Hs01_00043877 predicted 764
10 SASI_Hs01_00043875 predicted 909
11 SASI_Hs01_00043874 predicted 9632
12 SASI_Hs01_00043876 predicted 5513
13 SASI_Hs01_00043878 predicted 3524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354763 predicted 9046
2 SASI_Rn02_00354764 predicted 841
3 SASI_Rn02_00354765 predicted 1660
4 SASI_Rn02_00354766 predicted 3107
5 SASI_Rn02_00354767 predicted 7973
6 SASI_Rn02_00354768 predicted 6533
7 SASI_Rn02_00354769 predicted 8935
8 SASI_Rn02_00354770 predicted 6826
9 SASI_Rn02_00354771 predicted 7921
10 SASI_Rn02_00354772 predicted 6761
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226464 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383585 predicted 9837
2 SASI_Rn02_00383586 predicted 1568
3 SASI_Rn02_00383587 predicted 2391
4 SASI_Rn02_00383588 predicted 3835
5 SASI_Rn02_00383589 predicted 8762
6 SASI_Rn02_00383590 predicted 7321
7 SASI_Rn02_00383591 predicted 9722
8 SASI_Rn02_00383592 predicted 7612
9 SASI_Rn02_00383593 predicted 8707
10 SASI_Rn02_00383594 predicted 7549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034149 predicted 4307
2 SASI_Mm01_00034150 predicted 9712
3 SASI_Mm01_00034151 predicted 9754
4 SASI_Mm01_00034153 predicted 1588
5 SASI_Mm01_00034154 predicted 8681
6 SASI_Mm01_00034155 predicted 9388
7 SASI_Mm01_00034156 predicted 4444
8 SASI_Mm02_00311768 predicted 6575
9 SASI_Mm01_00034157 predicted 1147
10 SASI_Mm01_00034158 predicted 9709
11 SASI_Mm01_00034152 predicted 5532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006885
VALIDATED
ZFHX3 MISSION shRNA Bacterial Glycerol Stock
zinc finger homeobox 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006885.2-8918s1c1
Sequence:CCGGGCGATGCTCTTAGACTGTGATCTCGAGATCACAGTCTAAGAGCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006885.2-1720s1c1
Sequence:CCGGCCCTTTAGTTTCCACAGCTAACTCGAGTTAGCTGTGGAAACTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006885.2-10598s1c1
Sequence:CCGGCCTTACTTTGTACCAGGCTTTCTCGAGAAAGCCTGGTACAAAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006885.2-11325s1c1
Sequence:CCGGCCTTGCACAAACACAGAACAACTCGAGTTGTTCTGTGTTTGTGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006885.2-7562s1c1
Sequence:CCGGGCCAGGAAGAATTATGAGAATCTCGAGATTCTCATAATTCTTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006885.3-9908s21c1
Sequence:CCGGCAAGAGTTGGACCGGATTAAACTCGAGTTTAATCCGGTCCAACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006885.3-7143s21c1
Sequence:CCGGTCCGAGTCTTGCGGCAATATTCTCGAGAATATTGCCGCAAGACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006885.3-6536s21c1
Sequence:CCGGGAGTTGGTCATCCAGTATAATCTCGAGATTATACTGGATGACCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006885.3-2364s21c1
Sequence:CCGGCGAACAGGAGGAATCGTTTAACTCGAGTTAAACGATTCCTCCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006885.3-15042s21c1
Sequence:CCGGGGCTATGACCAGTACTATTTACTCGAGTAAATAGTACTGGTCATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006885
VALIDATED
ZFHX3 MISSION shRNA shRNA Plasmid DNA
zinc finger homeobox 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006885.2-8918s1c1
Sequence:CCGGGCGATGCTCTTAGACTGTGATCTCGAGATCACAGTCTAAGAGCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006885.2-1720s1c1
Sequence:CCGGCCCTTTAGTTTCCACAGCTAACTCGAGTTAGCTGTGGAAACTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006885.2-10598s1c1
Sequence:CCGGCCTTACTTTGTACCAGGCTTTCTCGAGAAAGCCTGGTACAAAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006885.2-11325s1c1
Sequence:CCGGCCTTGCACAAACACAGAACAACTCGAGTTGTTCTGTGTTTGTGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006885.2-7562s1c1
Sequence:CCGGGCCAGGAAGAATTATGAGAATCTCGAGATTCTCATAATTCTTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006885.3-9908s21c1
Sequence:CCGGCAAGAGTTGGACCGGATTAAACTCGAGTTTAATCCGGTCCAACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006885.3-7143s21c1
Sequence:CCGGTCCGAGTCTTGCGGCAATATTCTCGAGAATATTGCCGCAAGACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006885.3-6536s21c1
Sequence:CCGGGAGTTGGTCATCCAGTATAATCTCGAGATTATACTGGATGACCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006885.3-2364s21c1
Sequence:CCGGCGAACAGGAGGAATCGTTTAACTCGAGTTAAACGATTCCTCCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006885.3-15042s21c1
Sequence:CCGGGGCTATGACCAGTACTATTTACTCGAGTAAATAGTACTGGTCATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006885
VALIDATED
ZFHX3 MISSION shRNA Lentiviral Transduction Particles
zinc finger homeobox 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006885.2-8918s1c1
Sequence:CCGGGCGATGCTCTTAGACTGTGATCTCGAGATCACAGTCTAAGAGCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006885.2-1720s1c1
Sequence:CCGGCCCTTTAGTTTCCACAGCTAACTCGAGTTAGCTGTGGAAACTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006885.2-10598s1c1
Sequence:CCGGCCTTACTTTGTACCAGGCTTTCTCGAGAAAGCCTGGTACAAAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006885.2-11325s1c1
Sequence:CCGGCCTTGCACAAACACAGAACAACTCGAGTTGTTCTGTGTTTGTGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006885.2-7562s1c1
Sequence:CCGGGCCAGGAAGAATTATGAGAATCTCGAGATTCTCATAATTCTTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006885.3-9908s21c1
Sequence:CCGGCAAGAGTTGGACCGGATTAAACTCGAGTTTAATCCGGTCCAACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006885.3-7143s21c1
Sequence:CCGGTCCGAGTCTTGCGGCAATATTCTCGAGAATATTGCCGCAAGACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006885.3-6536s21c1
Sequence:CCGGGAGTTGGTCATCCAGTATAATCTCGAGATTATACTGGATGACCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006885.3-2364s21c1
Sequence:CCGGCGAACAGGAGGAATCGTTTAACTCGAGTTAAACGATTCCTCCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006885.3-15042s21c1
Sequence:CCGGGGCTATGACCAGTACTATTTACTCGAGTAAATAGTACTGGTCATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007496
ZFHX3 MISSION shRNA Bacterial Glycerol Stock
zinc finger homeobox 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-7640s1c1
Sequence:CCGGGCCAGGAAGAATTACGAGAATCTCGAGATTCTCGTAATTCTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-9002s1c1
Sequence:CCGGGCCATGCTCTTAGACTGTGATCTCGAGATCACAGTCTAAGAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-5896s1c1
Sequence:CCGGCCGGAAGAAGTTAGCGGATATCTCGAGATATCCGCTAACTTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-2503s1c1
Sequence:CCGGCGCTGACGAAAGTGCCAATAACTCGAGTTATTGGCACTTTCGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-5530s1c1
Sequence:CCGGCCCGGACAATAAGCCGTTTAACTCGAGTTAAACGGCTTATTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007496.2-2429s21c1
Sequence:CCGGGCGAACAGGAGGAGTCGTTTACTCGAGTAAACGACTCCTCCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007496.2-12096s21c1
Sequence:CCGGACCTATCTATGCCGGTGATTTCTCGAGAAATCACCGGCATAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007496.2-8685s21c1
Sequence:CCGGAGCGTTTGAGGACGACCATAACTCGAGTTATGGTCGTCCTCAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007496.2-5534s21c1
Sequence:CCGGCCGGACAATAAGCCGTTTAAGCTCGAGCTTAAACGGCTTATTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007496.2-5463s21c1
Sequence:CCGGTCTCGCACCTGCACAAGTTAACTCGAGTTAACTTGTGCAGGTGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007496
ZFHX3 MISSION shRNA shRNA Plasmid DNA
zinc finger homeobox 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-7640s1c1
Sequence:CCGGGCCAGGAAGAATTACGAGAATCTCGAGATTCTCGTAATTCTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-9002s1c1
Sequence:CCGGGCCATGCTCTTAGACTGTGATCTCGAGATCACAGTCTAAGAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-5896s1c1
Sequence:CCGGCCGGAAGAAGTTAGCGGATATCTCGAGATATCCGCTAACTTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-2503s1c1
Sequence:CCGGCGCTGACGAAAGTGCCAATAACTCGAGTTATTGGCACTTTCGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-5530s1c1
Sequence:CCGGCCCGGACAATAAGCCGTTTAACTCGAGTTAAACGGCTTATTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007496.2-2429s21c1
Sequence:CCGGGCGAACAGGAGGAGTCGTTTACTCGAGTAAACGACTCCTCCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007496.2-12096s21c1
Sequence:CCGGACCTATCTATGCCGGTGATTTCTCGAGAAATCACCGGCATAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007496.2-8685s21c1
Sequence:CCGGAGCGTTTGAGGACGACCATAACTCGAGTTATGGTCGTCCTCAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007496.2-5534s21c1
Sequence:CCGGCCGGACAATAAGCCGTTTAAGCTCGAGCTTAAACGGCTTATTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007496.2-5463s21c1
Sequence:CCGGTCTCGCACCTGCACAAGTTAACTCGAGTTAACTTGTGCAGGTGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007496
ZFHX3 MISSION shRNA Lentiviral Transduction Particles
zinc finger homeobox 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-7640s1c1
Sequence:CCGGGCCAGGAAGAATTACGAGAATCTCGAGATTCTCGTAATTCTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-9002s1c1
Sequence:CCGGGCCATGCTCTTAGACTGTGATCTCGAGATCACAGTCTAAGAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-5896s1c1
Sequence:CCGGCCGGAAGAAGTTAGCGGATATCTCGAGATATCCGCTAACTTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-2503s1c1
Sequence:CCGGCGCTGACGAAAGTGCCAATAACTCGAGTTATTGGCACTTTCGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007496.1-5530s1c1
Sequence:CCGGCCCGGACAATAAGCCGTTTAACTCGAGTTAAACGGCTTATTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007496.2-2429s21c1
Sequence:CCGGGCGAACAGGAGGAGTCGTTTACTCGAGTAAACGACTCCTCCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007496.2-12096s21c1
Sequence:CCGGACCTATCTATGCCGGTGATTTCTCGAGAAATCACCGGCATAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007496.2-8685s21c1
Sequence:CCGGAGCGTTTGAGGACGACCATAACTCGAGTTATGGTCGTCCTCAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007496.2-5534s21c1
Sequence:CCGGCCGGACAATAAGCCGTTTAAGCTCGAGCTTAAACGGCTTATTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007496.2-5463s21c1
Sequence:CCGGTCTCGCACCTGCACAAGTTAACTCGAGTTAACTTGTGCAGGTGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks