EMAIL THIS PAGE TO A FRIEND

ZFHX4

zinc finger homeobox 4

Synonyms: ZFH4 ZHF4
UniProtKB ID: Q86UP3, Q18PS0, Q6ZN20
Gene ID:
Mouse(80892) zinc finger homeodomain 4
Rat(310250) zinc finger homeobox 4
Zebrafish(556453) zinc finger homeobox 4
Horse(100050705) zinc finger homeobox 4
domestic cat(101083320) zinc finger homeobox 4
dog(487006) zinc finger homeobox 4
chicken(395904) zinc finger homeobox 4
naked mole-rat(101718522) zinc finger homeobox 4
Domestic Rabbit(100342782) zinc finger homeobox 4
domestic guinea pig(100727183) zinc finger homeobox 4
cow(539762) zinc finger homeobox 4
sheep(101110246) zinc finger homeobox 4
249 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024721 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024721 Rosetta Predictions human pricing
XM_001058915 Rosetta Predictions rat pricing
XM_226964 Rosetta Predictions rat pricing
NM_030708 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357190 predicted 1710
2 SASI_Hs01_00220468 predicted 3477
3 SASI_Hs01_00220469 predicted 5336
4 SASI_Hs01_00220470 predicted 8386
5 SASI_Hs01_00220471 predicted 4482
6 SASI_Hs01_00220472 predicted 3256
7 SASI_Hs01_00220473 predicted 8324
8 SASI_Hs01_00220474 predicted 2466
9 SASI_Hs02_00357191 predicted 1170
10 SASI_Hs02_00357192 predicted 9012
11 SASI_Hs01_00220467 predicted 3543
12 SASI_Hs01_00220475 predicted 4852
13 SASI_Hs01_00220476 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058915 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291243 predicted 8691
2 SASI_Rn02_00291244 predicted 3998
3 SASI_Rn02_00291245 predicted 2507
4 SASI_Rn02_00291246 predicted 8369
5 SASI_Rn02_00291247 predicted 6755
6 SASI_Rn02_00291248 predicted 6829
7 SASI_Rn02_00291249 predicted 7756
8 SASI_Rn02_00291250 predicted 6882
9 SASI_Rn02_00291251 predicted 832
10 SASI_Rn02_00291252 predicted 3343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383971 predicted 8694
2 SASI_Rn02_00383972 predicted 4000
3 SASI_Rn02_00383973 predicted 2503
4 SASI_Rn02_00383974 predicted 8364
5 SASI_Rn02_00383975 predicted 6752
6 SASI_Rn02_00383976 predicted 6825
7 SASI_Rn02_00383977 predicted 7756
8 SASI_Rn02_00383978 predicted 6888
9 SASI_Rn02_00383979 predicted 834
10 SASI_Rn02_00383980 predicted 3342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094873 predicted 646
2 SASI_Mm01_00094875 predicted 2054
3 SASI_Mm01_00094877 predicted 9011
4 SASI_Mm02_00336890 predicted 2493
5 SASI_Mm01_00094878 predicted 8394
6 SASI_Mm01_00094879 predicted 1279
7 SASI_Mm01_00094880 predicted 1686
8 SASI_Mm02_00336891 predicted 6854
9 SASI_Mm01_00094881 predicted 6909
10 SASI_Mm01_00094882 predicted 7024
11 SASI_Mm01_00094874 predicted 5872
12 SASI_Mm01_00094876 predicted 2114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030708
ZFHX4 MISSION shRNA Bacterial Glycerol Stock
zinc finger homeobox 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030708.2-8161s21c1
Sequence:CCGGACGCCTGAGCAACTCGAAATACTCGAGTATTTCGAGTTGCTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030708.2-4995s21c1
Sequence:CCGGCATTCTCTTGGTCCATTATAACTCGAGTTATAATGGACCAAGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030708.2-2485s21c1
Sequence:CCGGAGTTACACGTGTGGCTATAAACTCGAGTTTATAGCCACACGTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030708.2-820s21c1
Sequence:CCGGCCTGATGGATCAGCGTATATACTCGAGTATATACGCTGATCCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030708.2-11306s21c1
Sequence:CCGGATTGATATGCTGGCAATATAGCTCGAGCTATATTGCCAGCATATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030708.1-8226s1c1
Sequence:CCGGGCTGGGTATGACCAGAGTAAACTCGAGTTTACTCTGGTCATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030708.1-10845s1c1
Sequence:CCGGGCTGGCAATATAGGATGGTATCTCGAGATACCATCCTATATTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030708.1-3812s1c1
Sequence:CCGGCCCTGATGTAATGATGCTAAACTCGAGTTTAGCATCATTACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030708.1-4945s1c1
Sequence:CCGGCCCACTTAGATGCCAAAGAATCTCGAGATTCTTTGGCATCTAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030708.1-227s1c1
Sequence:CCGGGCTGGGTTTCAGCATTGAGAACTCGAGTTCTCAATGCTGAAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030708
ZFHX4 MISSION shRNA shRNA Plasmid DNA
zinc finger homeobox 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030708.2-8161s21c1
Sequence:CCGGACGCCTGAGCAACTCGAAATACTCGAGTATTTCGAGTTGCTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030708.2-4995s21c1
Sequence:CCGGCATTCTCTTGGTCCATTATAACTCGAGTTATAATGGACCAAGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030708.2-2485s21c1
Sequence:CCGGAGTTACACGTGTGGCTATAAACTCGAGTTTATAGCCACACGTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030708.2-820s21c1
Sequence:CCGGCCTGATGGATCAGCGTATATACTCGAGTATATACGCTGATCCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030708.2-11306s21c1
Sequence:CCGGATTGATATGCTGGCAATATAGCTCGAGCTATATTGCCAGCATATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030708.1-8226s1c1
Sequence:CCGGGCTGGGTATGACCAGAGTAAACTCGAGTTTACTCTGGTCATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030708.1-10845s1c1
Sequence:CCGGGCTGGCAATATAGGATGGTATCTCGAGATACCATCCTATATTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030708.1-3812s1c1
Sequence:CCGGCCCTGATGTAATGATGCTAAACTCGAGTTTAGCATCATTACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030708.1-4945s1c1
Sequence:CCGGCCCACTTAGATGCCAAAGAATCTCGAGATTCTTTGGCATCTAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030708.1-227s1c1
Sequence:CCGGGCTGGGTTTCAGCATTGAGAACTCGAGTTCTCAATGCTGAAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030708
ZFHX4 MISSION shRNA Lentiviral Transduction Particles
zinc finger homeobox 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030708.2-8161s21c1
Sequence:CCGGACGCCTGAGCAACTCGAAATACTCGAGTATTTCGAGTTGCTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030708.2-4995s21c1
Sequence:CCGGCATTCTCTTGGTCCATTATAACTCGAGTTATAATGGACCAAGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030708.2-2485s21c1
Sequence:CCGGAGTTACACGTGTGGCTATAAACTCGAGTTTATAGCCACACGTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030708.2-820s21c1
Sequence:CCGGCCTGATGGATCAGCGTATATACTCGAGTATATACGCTGATCCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030708.2-11306s21c1
Sequence:CCGGATTGATATGCTGGCAATATAGCTCGAGCTATATTGCCAGCATATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030708.1-8226s1c1
Sequence:CCGGGCTGGGTATGACCAGAGTAAACTCGAGTTTACTCTGGTCATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030708.1-10845s1c1
Sequence:CCGGGCTGGCAATATAGGATGGTATCTCGAGATACCATCCTATATTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030708.1-3812s1c1
Sequence:CCGGCCCTGATGTAATGATGCTAAACTCGAGTTTAGCATCATTACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030708.1-4945s1c1
Sequence:CCGGCCCACTTAGATGCCAAAGAATCTCGAGATTCTTTGGCATCTAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030708.1-227s1c1
Sequence:CCGGGCTGGGTTTCAGCATTGAGAACTCGAGTTCTCAATGCTGAAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024721
VALIDATED
ZFHX4 MISSION shRNA Bacterial Glycerol Stock
zinc finger homeobox 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024721.3-790s21c1
Sequence:CCGGCCTGATGGGTCAGCATATATACTCGAGTATATATGCTGACCCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024721.3-4857s21c1
Sequence:CCGGTGATCCATCTCGTCCATATAACTCGAGTTATATGGACGAGATGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024721.3-11243s21c1
Sequence:CCGGATTGATATGCTGGCAATATAGCTCGAGCTATATTGCCAGCATATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024721.3-10029s21c1
Sequence:CCGGCGGACAGTTCTTGCCATACTTCTCGAGAAGTATGGCAAGAACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024721.3-2976s21c1
Sequence:CCGGCGGAGAGCTGTCACCTTATATCTCGAGATATAAGGTGACAGCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024721.2-6874s1c1
Sequence:CCGGCCAGGATCTTTGACTTGATTACTCGAGTAATCAAGTCAAAGATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024721.2-1274s1c1
Sequence:CCGGGCTGTCTAGTTTAGTAGTGAACTCGAGTTCACTACTAAACTAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024721.2-9674s1c1
Sequence:CCGGCGGACAGTTCTTGCCATACTTCTCGAGAAGTATGGCAAGAACTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024721.2-289s1c1
Sequence:CCGGGCAACGAATGTGCCACTTCTTCTCGAGAAGAAGTGGCACATTCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024721.2-4983s1c1
Sequence:CCGGGCACAAATTCAGATGCAACTACTCGAGTAGTTGCATCTGAATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024721
VALIDATED
ZFHX4 MISSION shRNA shRNA Plasmid DNA
zinc finger homeobox 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024721.3-790s21c1
Sequence:CCGGCCTGATGGGTCAGCATATATACTCGAGTATATATGCTGACCCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024721.3-4857s21c1
Sequence:CCGGTGATCCATCTCGTCCATATAACTCGAGTTATATGGACGAGATGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024721.3-11243s21c1
Sequence:CCGGATTGATATGCTGGCAATATAGCTCGAGCTATATTGCCAGCATATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024721.3-10029s21c1
Sequence:CCGGCGGACAGTTCTTGCCATACTTCTCGAGAAGTATGGCAAGAACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024721.3-2976s21c1
Sequence:CCGGCGGAGAGCTGTCACCTTATATCTCGAGATATAAGGTGACAGCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024721.2-6874s1c1
Sequence:CCGGCCAGGATCTTTGACTTGATTACTCGAGTAATCAAGTCAAAGATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024721.2-1274s1c1
Sequence:CCGGGCTGTCTAGTTTAGTAGTGAACTCGAGTTCACTACTAAACTAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024721.2-9674s1c1
Sequence:CCGGCGGACAGTTCTTGCCATACTTCTCGAGAAGTATGGCAAGAACTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024721.2-289s1c1
Sequence:CCGGGCAACGAATGTGCCACTTCTTCTCGAGAAGAAGTGGCACATTCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024721.2-4983s1c1
Sequence:CCGGGCACAAATTCAGATGCAACTACTCGAGTAGTTGCATCTGAATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024721
VALIDATED
ZFHX4 MISSION shRNA Lentiviral Transduction Particles
zinc finger homeobox 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024721.3-790s21c1
Sequence:CCGGCCTGATGGGTCAGCATATATACTCGAGTATATATGCTGACCCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024721.3-4857s21c1
Sequence:CCGGTGATCCATCTCGTCCATATAACTCGAGTTATATGGACGAGATGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024721.3-11243s21c1
Sequence:CCGGATTGATATGCTGGCAATATAGCTCGAGCTATATTGCCAGCATATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024721.3-10029s21c1
Sequence:CCGGCGGACAGTTCTTGCCATACTTCTCGAGAAGTATGGCAAGAACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024721.3-2976s21c1
Sequence:CCGGCGGAGAGCTGTCACCTTATATCTCGAGATATAAGGTGACAGCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024721.2-6874s1c1
Sequence:CCGGCCAGGATCTTTGACTTGATTACTCGAGTAATCAAGTCAAAGATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024721.2-1274s1c1
Sequence:CCGGGCTGTCTAGTTTAGTAGTGAACTCGAGTTCACTACTAAACTAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024721.2-9674s1c1
Sequence:CCGGCGGACAGTTCTTGCCATACTTCTCGAGAAGTATGGCAAGAACTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024721.2-289s1c1
Sequence:CCGGGCAACGAATGTGCCACTTCTTCTCGAGAAGAAGTGGCACATTCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024721.2-4983s1c1
Sequence:CCGGGCACAAATTCAGATGCAACTACTCGAGTAGTTGCATCTGAATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks