EMAIL THIS PAGE TO A FRIEND

ZFP112

zinc finger protein 112 homolog (mouse)

Synonyms: ZNF112 ZNF228
Gene ID:
Mouse(57745) zinc finger protein 112
Rat(308420) zinc finger protein 112
domestic guinea pig(100716892) zinc finger protein 112 homolog (mouse)
Domestic Rabbit(100353388) zinc finger protein 112 homolog (mouse)
naked mole-rat(101728152) zinc finger protein 112 homolog (mouse)
cow(538686) zinc finger protein 112 homolog (mouse)
Horse(100070521) zinc finger protein 112 homolog (mouse)
domestic cat(101098269) zinc finger protein 112 homolog (mouse)
dog(100687886) zinc finger protein 112 homolog (mouse)
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA023856 Anti-ZFP112 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2102826 Anti-ZNF228 antibody produced in rabbit affinity isolated antibody human, canine, horse, rat, bovine, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013380 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013380 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013380 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083335 Rosetta Predictions human pricing
NM_013380 Rosetta Predictions human pricing
NM_001107487 Rosetta Predictions rat pricing
NM_021307 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316920 predicted 1500
2 SASI_Hs02_00316921 predicted 678
3 SASI_Hs02_00316922 predicted 2309
4 SASI_Hs02_00316923 predicted 1223
5 SASI_Hs02_00316924 predicted 1537
6 SASI_Hs02_00316925 predicted 627
7 SASI_Hs02_00316926 predicted 1598
8 SASI_Hs02_00316927 predicted 513
9 SASI_Hs02_00316928 predicted 366
10 SASI_Hs02_00316929 predicted 2637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081275 predicted 1449
2 SASI_Hs02_00344732 predicted 629
3 SASI_Hs01_00081276 predicted 2258
4 SASI_Hs01_00081277 predicted 1170
5 SASI_Hs01_00081278 predicted 1487
6 SASI_Hs01_00081279 predicted 1552
7 SASI_Hs01_00081280 predicted 472
8 SASI_Hs02_00344733 predicted 317
9 SASI_Hs01_00081283 predicted 2589
10 SASI_Hs02_00344734 predicted 2831
11 SASI_Hs01_00081274 predicted 1479
12 SASI_Hs01_00081281 predicted 1381
13 SASI_Hs01_00081282 predicted 2259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229315 predicted 1536
2 SASI_Rn02_00229316 predicted 446
3 SASI_Rn02_00229317 predicted 1234
4 SASI_Rn02_00229318 predicted 771
5 SASI_Rn02_00229319 predicted 1621
6 SASI_Rn02_00229320 predicted 1469
7 SASI_Rn02_00229321 predicted 2621
8 SASI_Rn02_00229322 predicted 442
9 SASI_Rn02_00229323 predicted 1305
10 SASI_Rn02_00229324 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080785 predicted 2210
2 SASI_Mm02_00325852 predicted 1572
3 SASI_Mm01_00080786 predicted 996
4 SASI_Mm01_00080787 predicted 1750
5 SASI_Mm01_00080788 predicted 2437
6 SASI_Mm01_00080789 predicted 1998
7 SASI_Mm01_00080790 predicted 1837
8 SASI_Mm01_00080791 predicted 865
9 SASI_Mm01_00080792 predicted 764
10 SASI_Mm01_00080793 predicted 659
11 SASI_Mm01_00080794 predicted 1430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021307
ZFP112 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 112 homolog (mouse)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021307.1-2831s1c1
Sequence:CCGGCCATGAACACTGACAGTGATTCTCGAGAATCACTGTCAGTGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021307.1-2140s1c1
Sequence:CCGGGCAAGAACTTTAGTCAGAAATCTCGAGATTTCTGACTAAAGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021307.1-739s1c1
Sequence:CCGGCCATAAGAAATCACTTCTGTACTCGAGTACAGAAGTGATTTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021307.1-1984s1c1
Sequence:CCGGGCTGGAGCTTTAACCTTCAAACTCGAGTTTGAAGGTTAAAGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021307.1-2742s1c1
Sequence:CCGGCCTGAGAACCTATGCAGAAATCTCGAGATTTCTGCATAGGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021307
ZFP112 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 112 homolog (mouse)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021307.1-2831s1c1
Sequence:CCGGCCATGAACACTGACAGTGATTCTCGAGAATCACTGTCAGTGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021307.1-2140s1c1
Sequence:CCGGGCAAGAACTTTAGTCAGAAATCTCGAGATTTCTGACTAAAGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021307.1-739s1c1
Sequence:CCGGCCATAAGAAATCACTTCTGTACTCGAGTACAGAAGTGATTTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021307.1-1984s1c1
Sequence:CCGGGCTGGAGCTTTAACCTTCAAACTCGAGTTTGAAGGTTAAAGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021307.1-2742s1c1
Sequence:CCGGCCTGAGAACCTATGCAGAAATCTCGAGATTTCTGCATAGGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021307
ZFP112 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 112 homolog (mouse)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021307.1-2831s1c1
Sequence:CCGGCCATGAACACTGACAGTGATTCTCGAGAATCACTGTCAGTGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021307.1-2140s1c1
Sequence:CCGGGCAAGAACTTTAGTCAGAAATCTCGAGATTTCTGACTAAAGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021307.1-739s1c1
Sequence:CCGGCCATAAGAAATCACTTCTGTACTCGAGTACAGAAGTGATTTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021307.1-1984s1c1
Sequence:CCGGGCTGGAGCTTTAACCTTCAAACTCGAGTTTGAAGGTTAAAGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021307.1-2742s1c1
Sequence:CCGGCCTGAGAACCTATGCAGAAATCTCGAGATTTCTGCATAGGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013380
VALIDATED
ZFP112 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 112 homolog (mouse)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013380.2-2865s1c1
Sequence:CCGGCCCAACTTCAACATTCATAATCTCGAGATTATGAATGTTGAAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013380.2-1698s1c1
Sequence:CCGGGCGAGGAATGTGATAAGGGATCTCGAGATCCCTTATCACATTCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013380.2-2707s1c1
Sequence:CCGGCGAAGACTATGGTAAGGACTACTCGAGTAGTCCTTACCATAGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013380.2-804s1c1
Sequence:CCGGCCTATCCATGTACTGGGTATACTCGAGTATACCCAGTACATGGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013380.2-1022s1c1
Sequence:CCGGCCATGCAAATGTGGTGAATATCTCGAGATATTCACCACATTTGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013380.3-549s21c1
Sequence:CCGGTAGGGAATGGCTCCAATTATACTCGAGTATAATTGGAGCCATTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_013380.3-1459s21c1
Sequence:CCGGCACTAAGGAACAACCATATAACTCGAGTTATATGGTTGTTCCTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013380.3-3052s21c1
Sequence:CCGGAGTGATGAGCATGCCTAAATCCTCGAGGATTTAGGCATGCTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_013380.3-1357s21c1
Sequence:GTACCGGCATTCAGCATAGGGTTCATATCTCGAGATATGAACCCTATGCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013380.3-1169s21c1
Sequence:CCGGAGTCATAGCTTAGACCTTAATCTCGAGATTAAGGTCTAAGCTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013380
VALIDATED
ZFP112 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 112 homolog (mouse)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013380.2-2865s1c1
Sequence:CCGGCCCAACTTCAACATTCATAATCTCGAGATTATGAATGTTGAAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013380.2-1698s1c1
Sequence:CCGGGCGAGGAATGTGATAAGGGATCTCGAGATCCCTTATCACATTCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013380.2-2707s1c1
Sequence:CCGGCGAAGACTATGGTAAGGACTACTCGAGTAGTCCTTACCATAGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013380.2-804s1c1
Sequence:CCGGCCTATCCATGTACTGGGTATACTCGAGTATACCCAGTACATGGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013380.2-1022s1c1
Sequence:CCGGCCATGCAAATGTGGTGAATATCTCGAGATATTCACCACATTTGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013380.3-549s21c1
Sequence:CCGGTAGGGAATGGCTCCAATTATACTCGAGTATAATTGGAGCCATTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_013380.3-1459s21c1
Sequence:CCGGCACTAAGGAACAACCATATAACTCGAGTTATATGGTTGTTCCTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013380.3-3052s21c1
Sequence:CCGGAGTGATGAGCATGCCTAAATCCTCGAGGATTTAGGCATGCTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_013380.3-1357s21c1
Sequence:GTACCGGCATTCAGCATAGGGTTCATATCTCGAGATATGAACCCTATGCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013380.3-1169s21c1
Sequence:CCGGAGTCATAGCTTAGACCTTAATCTCGAGATTAAGGTCTAAGCTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013380
VALIDATED
ZFP112 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 112 homolog (mouse)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013380.2-2865s1c1
Sequence:CCGGCCCAACTTCAACATTCATAATCTCGAGATTATGAATGTTGAAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013380.2-1698s1c1
Sequence:CCGGGCGAGGAATGTGATAAGGGATCTCGAGATCCCTTATCACATTCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013380.2-2707s1c1
Sequence:CCGGCGAAGACTATGGTAAGGACTACTCGAGTAGTCCTTACCATAGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013380.2-804s1c1
Sequence:CCGGCCTATCCATGTACTGGGTATACTCGAGTATACCCAGTACATGGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013380.2-1022s1c1
Sequence:CCGGCCATGCAAATGTGGTGAATATCTCGAGATATTCACCACATTTGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013380.3-549s21c1
Sequence:CCGGTAGGGAATGGCTCCAATTATACTCGAGTATAATTGGAGCCATTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_013380.3-1459s21c1
Sequence:CCGGCACTAAGGAACAACCATATAACTCGAGTTATATGGTTGTTCCTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013380.3-3052s21c1
Sequence:CCGGAGTGATGAGCATGCCTAAATCCTCGAGGATTTAGGCATGCTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_013380.3-1357s21c1
Sequence:GTACCGGCATTCAGCATAGGGTTCATATCTCGAGATATGAACCCTATGCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013380.3-1169s21c1
Sequence:CCGGAGTCATAGCTTAGACCTTAATCTCGAGATTAAGGTCTAAGCTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks