EMAIL THIS PAGE TO A FRIEND

ZFP14

ZFP14 zinc finger protein

Synonyms: ZNF531
UniProtKB ID: Q9HCL3, A7MD23
Gene ID:
Mouse(243906) zinc finger protein 14
Rat(499124) zinc finger protein 14 homolog (mouse)
cow(615112) ZFP14 zinc finger protein
sheep(101123228) zinc finger protein 14 homolog (mouse)
domestic guinea pig(100728602) ZFP14 zinc finger protein
naked mole-rat(101717928) ZFP14 zinc finger protein
Domestic Rabbit(100343714) zinc finger protein 14 homolog (mouse)
Horse(100630865) zinc finger protein 14 homolog (mouse)
domestic cat(101085088) zinc finger protein 14 homolog (mouse)
dog(100683244) zinc finger protein 14 homolog (mouse)
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020917 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020917 Rosetta Predictions human pricing
NM_001100991 Rosetta Predictions rat pricing
XM_574418 Rosetta Predictions rat pricing
NM_011748 Rosetta Predictions mouse pricing
NM_178733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135017 predicted 1144
2 SASI_Hs01_00135018 predicted 1700
3 SASI_Hs02_00354279 predicted 983
4 SASI_Hs01_00135019 predicted 570
5 SASI_Hs01_00135020 predicted 1055
6 SASI_Hs01_00135021 predicted 1299
7 SASI_Hs01_00135022 predicted 273
8 SASI_Hs01_00135023 predicted 803
9 SASI_Hs01_00135024 predicted 325
10 SASI_Hs01_00135025 predicted 488
11 SASI_Hs01_00135026 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211052 predicted 682
2 SASI_Rn02_00211053 predicted 1858
3 SASI_Rn02_00211054 predicted 605
4 SASI_Rn02_00211055 predicted 1554
5 SASI_Rn02_00211056 predicted 1034
6 SASI_Rn02_00211057 predicted 1503
7 SASI_Rn02_00211058 predicted 890
8 SASI_Rn02_00211059 predicted 1997
9 SASI_Rn02_00211060 predicted 583
10 SASI_Rn02_00211061 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00188070 predicted 372
2 SASI_Rn01_00188071 predicted 393
3 SASI_Rn01_00188072 predicted 348
4 SASI_Rn01_00188073 predicted 410
5 SASI_Rn01_00188074 predicted 352
6 SASI_Rn01_00188075 predicted 409
7 SASI_Rn01_00188076 predicted 350
8 SASI_Rn01_00188077 predicted 354
9 SASI_Rn01_00188078 predicted 1001
10 SASI_Rn01_00188079 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049503 predicted 1536
2 SASI_Mm01_00049504 predicted 1427
3 SASI_Mm01_00049505 predicted 547
4 SASI_Mm01_00049506 predicted 477
5 SASI_Mm01_00049507 predicted 1317
6 SASI_Mm01_00049508 predicted 1214
7 SASI_Mm01_00049509 predicted 466
8 SASI_Mm01_00049510 predicted 454
9 SASI_Mm01_00049511 predicted 1859
10 SASI_Mm01_00049512 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102615 predicted 1477
2 SASI_Mm01_00102616 predicted 1358
3 SASI_Mm01_00102617 predicted 484
4 SASI_Mm01_00102618 predicted 413
5 SASI_Mm01_00102619 predicted 1256
6 SASI_Mm01_00102620 predicted 1149
7 SASI_Mm01_00102621 predicted 404
8 SASI_Mm01_00102622 predicted 388
9 SASI_Mm01_00102623 predicted 1789
10 SASI_Mm01_00102624 predicted 1032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178733
ZFP14 MISSION shRNA Bacterial Glycerol Stock
ZFP14 zinc finger protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-395s1c1
Sequence:CCGGCAAGGGCATTTGTGAAGTATACTCGAGTATACTTCACAAATGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-591s1c1
Sequence:CCGGCTTTCTGAGTACCAGAGAGTTCTCGAGAACTCTCTGGTACTCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-1148s1c1
Sequence:CCGGCTGTGGTAAGTCCTTCAGAATCTCGAGATTCTGAAGGACTTACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-423s1c1
Sequence:CCGGCAGTGGGAGTTGATTGAGAAACTCGAGTTTCTCAATCAACTCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-1347s1c1
Sequence:CCGGCTGATTTCACATCAGAGCATTCTCGAGAATGCTCTGATGTGAAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178733
ZFP14 MISSION shRNA shRNA Plasmid DNA
ZFP14 zinc finger protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-395s1c1
Sequence:CCGGCAAGGGCATTTGTGAAGTATACTCGAGTATACTTCACAAATGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-591s1c1
Sequence:CCGGCTTTCTGAGTACCAGAGAGTTCTCGAGAACTCTCTGGTACTCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-1148s1c1
Sequence:CCGGCTGTGGTAAGTCCTTCAGAATCTCGAGATTCTGAAGGACTTACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-423s1c1
Sequence:CCGGCAGTGGGAGTTGATTGAGAAACTCGAGTTTCTCAATCAACTCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-1347s1c1
Sequence:CCGGCTGATTTCACATCAGAGCATTCTCGAGAATGCTCTGATGTGAAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178733
ZFP14 MISSION shRNA Lentiviral Transduction Particles
ZFP14 zinc finger protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-395s1c1
Sequence:CCGGCAAGGGCATTTGTGAAGTATACTCGAGTATACTTCACAAATGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-591s1c1
Sequence:CCGGCTTTCTGAGTACCAGAGAGTTCTCGAGAACTCTCTGGTACTCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-1148s1c1
Sequence:CCGGCTGTGGTAAGTCCTTCAGAATCTCGAGATTCTGAAGGACTTACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-423s1c1
Sequence:CCGGCAGTGGGAGTTGATTGAGAAACTCGAGTTTCTCAATCAACTCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178733.3-1347s1c1
Sequence:CCGGCTGATTTCACATCAGAGCATTCTCGAGAATGCTCTGATGTGAAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020917
ZFP14 MISSION shRNA Bacterial Glycerol Stock
ZFP14 zinc finger protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020917.1-3514s1c1
Sequence:CCGGCCCAACTCATTATTCTTGAAACTCGAGTTTCAAGAATAATGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020917.1-808s1c1
Sequence:CCGGGTGCTCCAAGAACTTACTCAACTCGAGTTGAGTAAGTTCTTGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020917.1-883s1c1
Sequence:CCGGGCCTTTAGAGTACATCAGCAACTCGAGTTGCTGATGTACTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020917.1-350s1c1
Sequence:CCGGCCAATACTTTATCTCCAGAAACTCGAGTTTCTGGAGATAAAGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020917.1-1387s1c1
Sequence:CCGGGCCTTTAGACTGCTCTCACAACTCGAGTTGTGAGAGCAGTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020917
ZFP14 MISSION shRNA shRNA Plasmid DNA
ZFP14 zinc finger protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020917.1-3514s1c1
Sequence:CCGGCCCAACTCATTATTCTTGAAACTCGAGTTTCAAGAATAATGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020917.1-808s1c1
Sequence:CCGGGTGCTCCAAGAACTTACTCAACTCGAGTTGAGTAAGTTCTTGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020917.1-883s1c1
Sequence:CCGGGCCTTTAGAGTACATCAGCAACTCGAGTTGCTGATGTACTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020917.1-350s1c1
Sequence:CCGGCCAATACTTTATCTCCAGAAACTCGAGTTTCTGGAGATAAAGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020917.1-1387s1c1
Sequence:CCGGGCCTTTAGACTGCTCTCACAACTCGAGTTGTGAGAGCAGTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020917
ZFP14 MISSION shRNA Lentiviral Transduction Particles
ZFP14 zinc finger protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020917.1-3514s1c1
Sequence:CCGGCCCAACTCATTATTCTTGAAACTCGAGTTTCAAGAATAATGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020917.1-808s1c1
Sequence:CCGGGTGCTCCAAGAACTTACTCAACTCGAGTTGAGTAAGTTCTTGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020917.1-883s1c1
Sequence:CCGGGCCTTTAGAGTACATCAGCAACTCGAGTTGCTGATGTACTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020917.1-350s1c1
Sequence:CCGGCCAATACTTTATCTCCAGAAACTCGAGTTTCTGGAGATAAAGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020917.1-1387s1c1
Sequence:CCGGGCCTTTAGACTGCTCTCACAACTCGAGTTGTGAGAGCAGTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks