EMAIL THIS PAGE TO A FRIEND

ZFP1

ZFP1 zinc finger protein

Synonyms: ZNF475
UniProtKB ID: Q6P2D0, A8K5Q7, B4DKG9, Q8N188, Q8N9F9
Gene ID:
Mouse(22640) zinc finger protein 1
Rat(498952) zinc finger protein 1
Thale Cress(844412) zinc finger protein 1
dog(100687945) zinc finger protein 1 homolog (mouse)
domestic cat(101090915) zinc finger protein 1 homolog (mouse)
domestic guinea pig(100714861) ZFP1 zinc finger protein
Domestic Rabbit(100350074) zinc finger protein 1 homolog (mouse)
naked mole-rat(101710655) ZFP1 zinc finger protein
cow(513942) ZFP1 zinc finger protein
sheep(101117187) zinc finger protein 1 homolog (mouse)
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153688 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153688 Rosetta Predictions human pricing
XM_001077676 Rosetta Predictions rat pricing
XM_574241 Rosetta Predictions rat pricing
NM_001037665 Rosetta Predictions mouse pricing
NM_011742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045309 predicted 693
2 SASI_Hs01_00045310 predicted 1367
3 SASI_Hs01_00045311 predicted 513
4 SASI_Hs01_00045313 predicted 800
5 SASI_Hs01_00045314 predicted 695
6 SASI_Hs01_00045315 predicted 611
7 SASI_Hs01_00045316 predicted 464
8 SASI_Hs01_00045317 predicted 982
9 SASI_Hs01_00045318 predicted 400
10 SASI_Hs02_00367401 predicted 702
11 SASI_Hs01_00045312 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358030 predicted 948
2 SASI_Rn02_00358031 predicted 624
3 SASI_Rn02_00358032 predicted 722
4 SASI_Rn02_00358033 predicted 1257
5 SASI_Rn02_00358034 predicted 253
6 SASI_Rn02_00358035 predicted 326
7 SASI_Rn02_00358036 predicted 361
8 SASI_Rn02_00358037 predicted 286
9 SASI_Rn02_00358038 predicted 799
10 SASI_Rn02_00358039 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401634 predicted 943
2 SASI_Rn02_00401635 predicted 620
3 SASI_Rn02_00401636 predicted 719
4 SASI_Rn02_00401637 predicted 1257
5 SASI_Rn02_00401638 predicted 251
6 SASI_Rn02_00401639 predicted 321
7 SASI_Rn02_00401640 predicted 364
8 SASI_Rn02_00401641 predicted 288
9 SASI_Rn02_00401642 predicted 797
10 SASI_Rn02_00401643 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289315 predicted 1137
2 SASI_Mm01_00077375 predicted 490
3 SASI_Mm01_00077376 predicted 698
4 SASI_Mm01_00077377 predicted 771
5 SASI_Mm01_00077378 predicted 540
6 SASI_Mm01_00077379 predicted 1126
7 SASI_Mm01_00077380 predicted 541
8 SASI_Mm01_00077381 predicted 508
9 SASI_Mm01_00077382 predicted 950
10 SASI_Mm01_00077383 predicted 715
11 SASI_Mm01_00077384 predicted 1139
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321323 predicted 1095
2 SASI_Mm01_00097125 predicted 450
3 SASI_Mm01_00097126 predicted 659
4 SASI_Mm01_00097127 predicted 722
5 SASI_Mm01_00097128 predicted 502
6 SASI_Mm01_00097129 predicted 1078
7 SASI_Mm01_00097130 predicted 499
8 SASI_Mm01_00097131 predicted 471
9 SASI_Mm01_00097132 predicted 903
10 SASI_Mm01_00097133 predicted 666
11 SASI_Mm01_00097134 predicted 1102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011742
ZFP1 MISSION shRNA Bacterial Glycerol Stock
ZFP1 zinc finger protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011742.2-465s21c1
Sequence:CCGGTAAGACAAGTTCCCTATAAATCTCGAGATTTATAGGGAACTTGTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011742.2-622s21c1
Sequence:CCGGACTGGAATACTCAGAATATAACTCGAGTTATATTCTGAGTATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011742.2-1525s21c1
Sequence:CCGGGGATACCTAAGAATATTATACCTCGAGGTATAATATTCTTAGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011742.2-908s21c1
Sequence:CCGGGCCTTTACCCACCAGTCAAACCTCGAGGTTTGACTGGTGGGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011742.2-663s21c1
Sequence:CCGGGCCATAAGGATGCCATCTTTACTCGAGTAAAGATGGCATCCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011742.1-1738s1c1
Sequence:CCGGCCATCTGTAATGGGATCCTATCTCGAGATAGGATCCCATTACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011742.1-783s1c1
Sequence:CCGGGCCATCTTTAAACATCGGAAACTCGAGTTTCCGATGTTTAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011742.1-641s1c1
Sequence:CCGGCAGTAGAAACTGTGTAAGAAACTCGAGTTTCTTACACAGTTTCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011742.1-693s1c1
Sequence:CCGGCCACTTCTGTACCTGAAGCAACTCGAGTTGCTTCAGGTACAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011742.1-640s1c1
Sequence:CCGGGCAGTAGAAACTGTGTAAGAACTCGAGTTCTTACACAGTTTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011742
ZFP1 MISSION shRNA shRNA Plasmid DNA
ZFP1 zinc finger protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011742.2-465s21c1
Sequence:CCGGTAAGACAAGTTCCCTATAAATCTCGAGATTTATAGGGAACTTGTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011742.2-622s21c1
Sequence:CCGGACTGGAATACTCAGAATATAACTCGAGTTATATTCTGAGTATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011742.2-1525s21c1
Sequence:CCGGGGATACCTAAGAATATTATACCTCGAGGTATAATATTCTTAGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011742.2-908s21c1
Sequence:CCGGGCCTTTACCCACCAGTCAAACCTCGAGGTTTGACTGGTGGGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011742.2-663s21c1
Sequence:CCGGGCCATAAGGATGCCATCTTTACTCGAGTAAAGATGGCATCCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011742.1-1738s1c1
Sequence:CCGGCCATCTGTAATGGGATCCTATCTCGAGATAGGATCCCATTACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011742.1-783s1c1
Sequence:CCGGGCCATCTTTAAACATCGGAAACTCGAGTTTCCGATGTTTAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011742.1-641s1c1
Sequence:CCGGCAGTAGAAACTGTGTAAGAAACTCGAGTTTCTTACACAGTTTCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011742.1-693s1c1
Sequence:CCGGCCACTTCTGTACCTGAAGCAACTCGAGTTGCTTCAGGTACAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011742.1-640s1c1
Sequence:CCGGGCAGTAGAAACTGTGTAAGAACTCGAGTTCTTACACAGTTTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011742
ZFP1 MISSION shRNA Lentiviral Transduction Particles
ZFP1 zinc finger protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011742.2-465s21c1
Sequence:CCGGTAAGACAAGTTCCCTATAAATCTCGAGATTTATAGGGAACTTGTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011742.2-622s21c1
Sequence:CCGGACTGGAATACTCAGAATATAACTCGAGTTATATTCTGAGTATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011742.2-1525s21c1
Sequence:CCGGGGATACCTAAGAATATTATACCTCGAGGTATAATATTCTTAGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011742.2-908s21c1
Sequence:CCGGGCCTTTACCCACCAGTCAAACCTCGAGGTTTGACTGGTGGGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011742.2-663s21c1
Sequence:CCGGGCCATAAGGATGCCATCTTTACTCGAGTAAAGATGGCATCCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011742.1-1738s1c1
Sequence:CCGGCCATCTGTAATGGGATCCTATCTCGAGATAGGATCCCATTACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011742.1-783s1c1
Sequence:CCGGGCCATCTTTAAACATCGGAAACTCGAGTTTCCGATGTTTAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011742.1-641s1c1
Sequence:CCGGCAGTAGAAACTGTGTAAGAAACTCGAGTTTCTTACACAGTTTCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011742.1-693s1c1
Sequence:CCGGCCACTTCTGTACCTGAAGCAACTCGAGTTGCTTCAGGTACAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011742.1-640s1c1
Sequence:CCGGGCAGTAGAAACTGTGTAAGAACTCGAGTTCTTACACAGTTTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153688
VALIDATED
ZFP1 MISSION shRNA Bacterial Glycerol Stock
ZFP1 zinc finger protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_153688.2-906s21c1
Sequence:CCGGGCTTTCACCCACCAGTCAAACCTCGAGGTTTGACTGGTGGGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_153688.2-457s21c1
Sequence:CCGGCTTTAAGACAAGTACCTTATACTCGAGTATAAGGTACTTGTCTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_153688.2-752s21c1
Sequence:CCGGGTCACTCCTCATTAGTCATAACTCGAGTTATGACTAATGAGGAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153688.2-2772s21c1
Sequence:CCGGGATGTGCTGTCACACTATATACTCGAGTATATAGTGTGACAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153688.2-243s21c1
Sequence:CCGGCCCTCTCAGAGGATCCTATACCTCGAGGTATAGGATCCTCTGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153688.1-992s1c1
Sequence:CCGGGCAGTGAATGTGGAAAGACATCTCGAGATGTCTTTCCACATTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_153688.1-1269s1c1
Sequence:CCGGCCAGAGGTCAACTCTTAGATTCTCGAGAATCTAAGAGTTGACCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_153688.1-451s1c1
Sequence:CCGGCTTAATCTGAACACAGACTTTCTCGAGAAAGTCTGTGTTCAGATTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153688.1-676s1c1
Sequence:CCGGCTCAGCCATAAAGCAGCCATTCTCGAGAATGGCTGCTTTATGGCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_153688.1-601s1c1
Sequence:CCGGGCACTTCTCTACCTGAAGCAACTCGAGTTGCTTCAGGTAGAGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153688
VALIDATED
ZFP1 MISSION shRNA shRNA Plasmid DNA
ZFP1 zinc finger protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_153688.2-906s21c1
Sequence:CCGGGCTTTCACCCACCAGTCAAACCTCGAGGTTTGACTGGTGGGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_153688.2-457s21c1
Sequence:CCGGCTTTAAGACAAGTACCTTATACTCGAGTATAAGGTACTTGTCTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_153688.2-752s21c1
Sequence:CCGGGTCACTCCTCATTAGTCATAACTCGAGTTATGACTAATGAGGAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153688.2-2772s21c1
Sequence:CCGGGATGTGCTGTCACACTATATACTCGAGTATATAGTGTGACAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153688.2-243s21c1
Sequence:CCGGCCCTCTCAGAGGATCCTATACCTCGAGGTATAGGATCCTCTGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153688.1-992s1c1
Sequence:CCGGGCAGTGAATGTGGAAAGACATCTCGAGATGTCTTTCCACATTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_153688.1-1269s1c1
Sequence:CCGGCCAGAGGTCAACTCTTAGATTCTCGAGAATCTAAGAGTTGACCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_153688.1-451s1c1
Sequence:CCGGCTTAATCTGAACACAGACTTTCTCGAGAAAGTCTGTGTTCAGATTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153688.1-676s1c1
Sequence:CCGGCTCAGCCATAAAGCAGCCATTCTCGAGAATGGCTGCTTTATGGCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_153688.1-601s1c1
Sequence:CCGGGCACTTCTCTACCTGAAGCAACTCGAGTTGCTTCAGGTAGAGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153688
VALIDATED
ZFP1 MISSION shRNA Lentiviral Transduction Particles
ZFP1 zinc finger protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_153688.2-906s21c1
Sequence:CCGGGCTTTCACCCACCAGTCAAACCTCGAGGTTTGACTGGTGGGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_153688.2-457s21c1
Sequence:CCGGCTTTAAGACAAGTACCTTATACTCGAGTATAAGGTACTTGTCTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_153688.2-752s21c1
Sequence:CCGGGTCACTCCTCATTAGTCATAACTCGAGTTATGACTAATGAGGAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153688.2-2772s21c1
Sequence:CCGGGATGTGCTGTCACACTATATACTCGAGTATATAGTGTGACAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153688.2-243s21c1
Sequence:CCGGCCCTCTCAGAGGATCCTATACCTCGAGGTATAGGATCCTCTGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153688.1-992s1c1
Sequence:CCGGGCAGTGAATGTGGAAAGACATCTCGAGATGTCTTTCCACATTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_153688.1-1269s1c1
Sequence:CCGGCCAGAGGTCAACTCTTAGATTCTCGAGAATCTAAGAGTTGACCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_153688.1-451s1c1
Sequence:CCGGCTTAATCTGAACACAGACTTTCTCGAGAAAGTCTGTGTTCAGATTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153688.1-676s1c1
Sequence:CCGGCTCAGCCATAAAGCAGCCATTCTCGAGAATGGCTGCTTTATGGCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_153688.1-601s1c1
Sequence:CCGGGCACTTCTCTACCTGAAGCAACTCGAGTTGCTTCAGGTAGAGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks