EMAIL THIS PAGE TO A FRIEND

ZFP28

ZFP28 zinc finger protein

Synonyms: mkr5
UniProtKB ID: Q8NHY6, A0JNV6, Q9BY30, Q9P2B6
Gene ID:
Mouse(22690) zinc finger protein 28
Rat(690559) zinc finger protein 28
domestic guinea pig(101788927) ZFP28 zinc finger protein
naked mole-rat(101717523) ZFP28 zinc finger protein
dog(611144) zinc finger protein 28 homolog (mouse)
domestic cat(101101351) zinc finger protein 28 homolog (mouse)
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175247 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175247 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175247 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020828 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020828 Rosetta Predictions human pricing
XM_001074805 Rosetta Predictions rat pricing
NM_175247 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190468 predicted 1187
2 SASI_Hs01_00190469 predicted 2192
3 SASI_Hs02_00354066 predicted 1175
4 SASI_Hs01_00190470 predicted 718
5 SASI_Hs01_00190472 predicted 1212
6 SASI_Hs02_00354067 predicted 2446
7 SASI_Hs02_00354068 predicted 1540
8 SASI_Hs01_00190474 predicted 341
9 SASI_Hs01_00190475 predicted 1090
10 SASI_Hs01_00190476 predicted 1614
11 SASI_Hs01_00190467 predicted 1037
12 SASI_Hs01_00190471 predicted 818
13 SASI_Hs01_00190473 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347396 predicted 604
2 SASI_Rn02_00347397 predicted 683
3 SASI_Rn02_00347398 predicted 1480
4 SASI_Rn02_00347399 predicted 433
5 SASI_Rn02_00347400 predicted 1312
6 SASI_Rn02_00347401 predicted 1142
7 SASI_Rn02_00347402 predicted 444
8 SASI_Rn02_00347403 predicted 1443
9 SASI_Rn02_00347404 predicted 521
10 SASI_Rn02_00347405 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175247 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117248 predicted 2434
2 SASI_Mm01_00117249 predicted 2334
3 SASI_Mm02_00345941 predicted 84
4 SASI_Mm01_00117247 predicted 822
5 SASI_Mm01_00117250 predicted 939
6 SASI_Mm01_00117251 predicted 1550
7 SASI_Mm01_00117252 predicted 1488
8 SASI_Mm01_00117253 predicted 2086
9 SASI_Mm01_00117254 predicted 2086
10 SASI_Mm01_00117255 predicted 1887
11 SASI_Mm01_00117256 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175247
ZFP28 MISSION shRNA Bacterial Glycerol Stock
ZFP28 zinc finger protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175247.3-2501s21c1
Sequence:CCGGGTGGATCTCTTCTCCAAATTCCTCGAGGAATTTGGAGAAGAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175247.3-2736s21c1
Sequence:CCGGAGCACAGTGCCCGATTCATACCTCGAGGTATGAATCGGGCACTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175247.1-3034s1c1
Sequence:CCGGGCTGAACTGTATCATGGCTTTCTCGAGAAAGCCATGATACAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175247.1-1144s1c1
Sequence:CCGGCCTCAAATCCAGTAGTTGTAACTCGAGTTACAACTACTGGATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175247.1-2424s1c1
Sequence:CCGGGCTCACCATCAGCAGATTCATCTCGAGATGAATCTGCTGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175247.1-2164s1c1
Sequence:CCGGCGTCCCTTATCTGTCATCGTACTCGAGTACGATGACAGATAAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175247.1-2167s1c1
Sequence:CCGGCCCTTATCTGTCATCGTAGATCTCGAGATCTACGATGACAGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175247
ZFP28 MISSION shRNA shRNA Plasmid DNA
ZFP28 zinc finger protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175247.3-2501s21c1
Sequence:CCGGGTGGATCTCTTCTCCAAATTCCTCGAGGAATTTGGAGAAGAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175247.3-2736s21c1
Sequence:CCGGAGCACAGTGCCCGATTCATACCTCGAGGTATGAATCGGGCACTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175247.1-3034s1c1
Sequence:CCGGGCTGAACTGTATCATGGCTTTCTCGAGAAAGCCATGATACAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175247.1-1144s1c1
Sequence:CCGGCCTCAAATCCAGTAGTTGTAACTCGAGTTACAACTACTGGATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175247.1-2424s1c1
Sequence:CCGGGCTCACCATCAGCAGATTCATCTCGAGATGAATCTGCTGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175247.1-2164s1c1
Sequence:CCGGCGTCCCTTATCTGTCATCGTACTCGAGTACGATGACAGATAAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175247.1-2167s1c1
Sequence:CCGGCCCTTATCTGTCATCGTAGATCTCGAGATCTACGATGACAGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175247
ZFP28 MISSION shRNA Lentiviral Transduction Particles
ZFP28 zinc finger protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175247.3-2501s21c1
Sequence:CCGGGTGGATCTCTTCTCCAAATTCCTCGAGGAATTTGGAGAAGAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175247.3-2736s21c1
Sequence:CCGGAGCACAGTGCCCGATTCATACCTCGAGGTATGAATCGGGCACTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175247.1-3034s1c1
Sequence:CCGGGCTGAACTGTATCATGGCTTTCTCGAGAAAGCCATGATACAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175247.1-1144s1c1
Sequence:CCGGCCTCAAATCCAGTAGTTGTAACTCGAGTTACAACTACTGGATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175247.1-2424s1c1
Sequence:CCGGGCTCACCATCAGCAGATTCATCTCGAGATGAATCTGCTGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175247.1-2164s1c1
Sequence:CCGGCGTCCCTTATCTGTCATCGTACTCGAGTACGATGACAGATAAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175247.1-2167s1c1
Sequence:CCGGCCCTTATCTGTCATCGTAGATCTCGAGATCTACGATGACAGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020828
VALIDATED
ZFP28 MISSION shRNA Bacterial Glycerol Stock
ZFP28 zinc finger protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020828.1-1614s21c1
Sequence:CCGGAGTGACCACATAGGGCTTAATCTCGAGATTAAGCCCTATGTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020828.1-3834s21c1
Sequence:CCGGACAACTGTGACAGACTATATGCTCGAGCATATAGTCTGTCACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_020828.1-679s21c1
Sequence:CCGGAGAGACTCACAAGCTATAATCCTCGAGGATTATAGCTTGTGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020828.1-2462s21c1
Sequence:CCGGTGGACACCTTAATCAACATAACTCGAGTTATGTTGATTAAGGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020828.1-1546s21c1
Sequence:CCGGTCCGTCACTGGAGATACTATCCTCGAGGATAGTATCTCCAGTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020828.1-1885s1c1
Sequence:CCGGCCAGTCATTTAAGGATTCATACTCGAGTATGAATCCTTAAATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020828.1-494s1c1
Sequence:CCGGGCTGGGACTTTGTGTTTCTAACTCGAGTTAGAAACACAAAGTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020828.1-2622s1c1
Sequence:CCGGCCTGTGGATCTGTTTCCCAAACTCGAGTTTGGGAAACAGATCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020828.1-891s1c1
Sequence:CCGGCCAGATTTAGTCTCTTTACTACTCGAGTAGTAAAGAGACTAAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020828.1-2299s1c1
Sequence:CCGGCCCTTATTTGTCATCGCAGAACTCGAGTTCTGCGATGACAAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020828
VALIDATED
ZFP28 MISSION shRNA shRNA Plasmid DNA
ZFP28 zinc finger protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020828.1-1614s21c1
Sequence:CCGGAGTGACCACATAGGGCTTAATCTCGAGATTAAGCCCTATGTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020828.1-3834s21c1
Sequence:CCGGACAACTGTGACAGACTATATGCTCGAGCATATAGTCTGTCACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_020828.1-679s21c1
Sequence:CCGGAGAGACTCACAAGCTATAATCCTCGAGGATTATAGCTTGTGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020828.1-2462s21c1
Sequence:CCGGTGGACACCTTAATCAACATAACTCGAGTTATGTTGATTAAGGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020828.1-1546s21c1
Sequence:CCGGTCCGTCACTGGAGATACTATCCTCGAGGATAGTATCTCCAGTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020828.1-1885s1c1
Sequence:CCGGCCAGTCATTTAAGGATTCATACTCGAGTATGAATCCTTAAATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020828.1-494s1c1
Sequence:CCGGGCTGGGACTTTGTGTTTCTAACTCGAGTTAGAAACACAAAGTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020828.1-2622s1c1
Sequence:CCGGCCTGTGGATCTGTTTCCCAAACTCGAGTTTGGGAAACAGATCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020828.1-891s1c1
Sequence:CCGGCCAGATTTAGTCTCTTTACTACTCGAGTAGTAAAGAGACTAAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020828.1-2299s1c1
Sequence:CCGGCCCTTATTTGTCATCGCAGAACTCGAGTTCTGCGATGACAAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020828
VALIDATED
ZFP28 MISSION shRNA Lentiviral Transduction Particles
ZFP28 zinc finger protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020828.1-1614s21c1
Sequence:CCGGAGTGACCACATAGGGCTTAATCTCGAGATTAAGCCCTATGTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020828.1-3834s21c1
Sequence:CCGGACAACTGTGACAGACTATATGCTCGAGCATATAGTCTGTCACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_020828.1-679s21c1
Sequence:CCGGAGAGACTCACAAGCTATAATCCTCGAGGATTATAGCTTGTGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020828.1-2462s21c1
Sequence:CCGGTGGACACCTTAATCAACATAACTCGAGTTATGTTGATTAAGGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020828.1-1546s21c1
Sequence:CCGGTCCGTCACTGGAGATACTATCCTCGAGGATAGTATCTCCAGTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020828.1-1885s1c1
Sequence:CCGGCCAGTCATTTAAGGATTCATACTCGAGTATGAATCCTTAAATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020828.1-494s1c1
Sequence:CCGGGCTGGGACTTTGTGTTTCTAACTCGAGTTAGAAACACAAAGTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020828.1-2622s1c1
Sequence:CCGGCCTGTGGATCTGTTTCCCAAACTCGAGTTTGGGAAACAGATCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020828.1-891s1c1
Sequence:CCGGCCAGATTTAGTCTCTTTACTACTCGAGTAGTAAAGAGACTAAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020828.1-2299s1c1
Sequence:CCGGCCCTTATTTGTCATCGCAGAACTCGAGTTCTGCGATGACAAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks