EMAIL THIS PAGE TO A FRIEND

ZFP2

ZFP2 zinc finger protein

Synonyms: ZNF751
UniProtKB ID: Q6ZN57, A5PLN5, B7ZM23, Q9H6Z6
Gene ID:
Mouse(22678) zinc finger protein 2
Rat(497897) zinc finger protein 2
domestic guinea pig(100726791) ZFP2 zinc finger protein
Domestic Rabbit(100345031) zinc finger protein 2 homolog (mouse)
naked mole-rat(101717913) ZFP2 zinc finger protein
cow(767896) zinc finger protein 2 homolog (mouse)
sheep(101102977) zinc finger protein 2 homolog (mouse)
Thale Cress(835856) zinc finger protein 2
dog(100686191) zinc finger protein 2 homolog (mouse)
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030613 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141711 MISSION® esiRNA esiRNA human ZFP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030613 Rosetta Predictions human pricing
NM_001127558 Rosetta Predictions rat pricing
XM_573082 Rosetta Predictions rat pricing
NM_001044697 Rosetta Predictions mouse pricing
NM_001044698 Rosetta Predictions mouse pricing
NM_001044699 Rosetta Predictions mouse pricing
NM_001044700 Rosetta Predictions mouse pricing
NM_009550 Rosetta Predictions mouse pricing
NM_178447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173746 predicted 1990
2 SASI_Hs01_00173747 predicted 1928
3 SASI_Hs01_00173748 predicted 1004
4 SASI_Hs01_00173749 predicted 1255
5 SASI_Hs01_00173750 predicted 673
6 SASI_Hs01_00173751 predicted 1091
7 SASI_Hs01_00173752 predicted 1557
8 SASI_Hs01_00173753 predicted 1856
9 SASI_Hs01_00173754 predicted 1683
10 SASI_Hs01_00173755 predicted 1426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254333 predicted 579
2 SASI_Rn02_00254334 predicted 1119
3 SASI_Rn02_00254335 predicted 1296
4 SASI_Rn02_00254336 predicted 1648
5 SASI_Rn02_00254337 predicted 807
6 SASI_Rn02_00254338 predicted 1790
7 SASI_Rn02_00254339 predicted 713
8 SASI_Rn02_00254340 predicted 1289
9 SASI_Rn02_00254341 predicted 699
10 SASI_Rn02_00254342 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00148352 predicted 1154
2 SASI_Rn01_00148353 predicted 1176
3 SASI_Rn01_00148354 predicted 977
4 SASI_Rn01_00148355 predicted 1023
5 SASI_Rn01_00148356 predicted 1187
6 SASI_Rn01_00148357 predicted 1324
7 SASI_Rn01_00148358 predicted 1011
8 SASI_Rn01_00148359 predicted 1124
9 SASI_Rn01_00148360 predicted 993
10 SASI_Rn01_00148361 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291294 predicted 1637
2 SASI_Mm02_00291295 predicted 2017
3 SASI_Mm02_00291296 predicted 1592
4 SASI_Mm02_00291297 predicted 2032
5 SASI_Mm02_00291298 predicted 1529
6 SASI_Mm02_00291299 predicted 1689
7 SASI_Mm02_00291300 predicted 920
8 SASI_Mm02_00291301 predicted 1626
9 SASI_Mm02_00291302 predicted 1920
10 SASI_Mm02_00291303 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291304 predicted 1630
2 SASI_Mm02_00291305 predicted 2015
3 SASI_Mm02_00291306 predicted 1585
4 SASI_Mm02_00291307 predicted 2032
5 SASI_Mm02_00291308 predicted 1525
6 SASI_Mm02_00291309 predicted 1681
7 SASI_Mm02_00291310 predicted 922
8 SASI_Mm02_00291311 predicted 1622
9 SASI_Mm02_00291312 predicted 1921
10 SASI_Mm02_00291313 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291314 predicted 1594
2 SASI_Mm02_00291315 predicted 1972
3 SASI_Mm02_00291316 predicted 1552
4 SASI_Mm02_00291317 predicted 1993
5 SASI_Mm02_00291318 predicted 1486
6 SASI_Mm02_00291319 predicted 1644
7 SASI_Mm02_00291320 predicted 880
8 SASI_Mm02_00291321 predicted 1590
9 SASI_Mm02_00291322 predicted 1879
10 SASI_Mm02_00291323 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291324 predicted 1590
2 SASI_Mm02_00291325 predicted 1970
3 SASI_Mm02_00291326 predicted 1545
4 SASI_Mm02_00291327 predicted 1985
5 SASI_Mm02_00291328 predicted 1479
6 SASI_Mm02_00291329 predicted 1646
7 SASI_Mm02_00291330 predicted 879
8 SASI_Mm02_00291331 predicted 1578
9 SASI_Mm02_00291332 predicted 1876
10 SASI_Mm02_00291333 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200760 predicted 823
2 SASI_Mm01_00200761 predicted 607
3 SASI_Mm01_00200762 predicted 696
4 SASI_Mm01_00200763 predicted 635
5 SASI_Mm01_00200764 predicted 637
6 SASI_Mm01_00200765 predicted 810
7 SASI_Mm01_00200766 predicted 566
8 SASI_Mm01_00200767 predicted 776
9 SASI_Mm01_00200768 predicted 764
10 SASI_Mm01_00200769 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091685 predicted 1013
2 SASI_Mm01_00091686 predicted 795
3 SASI_Mm01_00091687 predicted 891
4 SASI_Mm01_00091688 predicted 827
5 SASI_Mm01_00091689 predicted 829
6 SASI_Mm01_00091690 predicted 1001
7 SASI_Mm01_00091691 predicted 763
8 SASI_Mm01_00091692 predicted 968
9 SASI_Mm01_00091693 predicted 966
10 SASI_Mm01_00091694 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009550
ZFP2 MISSION shRNA Bacterial Glycerol Stock
ZFP2 zinc finger protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009550.1-1647s1c1
Sequence:CCGGCCCTTGATTCAGATTTGAGTACTCGAGTACTCAAATCTGAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009550.1-1012s1c1
Sequence:CCGGCGCAAGAATTCATCCCTTATTCTCGAGAATAAGGGATGAATTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009550.1-821s1c1
Sequence:CCGGGCAACGTGTGTGACAAGCATTCTCGAGAATGCTTGTCACACACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009550.1-1011s1c1
Sequence:CCGGCCGCAAGAATTCATCCCTTATCTCGAGATAAGGGATGAATTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009550.1-1425s1c1
Sequence:CCGGGCCCTTCAGTAGGAGTACAAACTCGAGTTTGTACTCCTACTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009550
ZFP2 MISSION shRNA shRNA Plasmid DNA
ZFP2 zinc finger protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009550.1-1647s1c1
Sequence:CCGGCCCTTGATTCAGATTTGAGTACTCGAGTACTCAAATCTGAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009550.1-1012s1c1
Sequence:CCGGCGCAAGAATTCATCCCTTATTCTCGAGAATAAGGGATGAATTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009550.1-821s1c1
Sequence:CCGGGCAACGTGTGTGACAAGCATTCTCGAGAATGCTTGTCACACACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009550.1-1011s1c1
Sequence:CCGGCCGCAAGAATTCATCCCTTATCTCGAGATAAGGGATGAATTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009550.1-1425s1c1
Sequence:CCGGGCCCTTCAGTAGGAGTACAAACTCGAGTTTGTACTCCTACTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009550
ZFP2 MISSION shRNA Lentiviral Transduction Particles
ZFP2 zinc finger protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009550.1-1647s1c1
Sequence:CCGGCCCTTGATTCAGATTTGAGTACTCGAGTACTCAAATCTGAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009550.1-1012s1c1
Sequence:CCGGCGCAAGAATTCATCCCTTATTCTCGAGAATAAGGGATGAATTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009550.1-821s1c1
Sequence:CCGGGCAACGTGTGTGACAAGCATTCTCGAGAATGCTTGTCACACACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009550.1-1011s1c1
Sequence:CCGGCCGCAAGAATTCATCCCTTATCTCGAGATAAGGGATGAATTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009550.1-1425s1c1
Sequence:CCGGGCCCTTCAGTAGGAGTACAAACTCGAGTTTGTACTCCTACTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030613
ZFP2 MISSION shRNA Bacterial Glycerol Stock
ZFP2 zinc finger protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-1190s1c1
Sequence:CCGGCGGAGTACAAACCTTACACGACTCGAGTCGTGTAAGGTTTGTACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-341s1c1
Sequence:CCGGGCCTTTAGTCAGAGCATGAATCTCGAGATTCATGCTCTGACTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-1028s1c1
Sequence:CCGGGCTTACCTTATTGAACATCAACTCGAGTTGATGTTCAATAAGGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-152s1c1
Sequence:CCGGGAATGTAACCAGTGCAGCAAACTCGAGTTTGCTGCACTGGTTACATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-518s1c1
Sequence:CCGGCAAAGCATGAATTTGACAGTTCTCGAGAACTGTCAAATTCATGCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030613.2-637s21c1
Sequence:CCGGTGAGAGTATGTGGAGGTAATGCTCGAGCATTACCTCCACATACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030613.2-599s21c1
Sequence:CCGGCCAAGTGGGAGTTACCCATAACTCGAGTTATGGGTAACTCCCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030613.2-546s21c1
Sequence:CCGGGAAACCTGGGAACCTAATAATCTCGAGATTATTAGGTTCCCAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030613.2-1262s21c1
Sequence:CCGGCAGTCAAAGCATGCATCTTATCTCGAGATAAGATGCATGCTTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030613
ZFP2 MISSION shRNA shRNA Plasmid DNA
ZFP2 zinc finger protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-1190s1c1
Sequence:CCGGCGGAGTACAAACCTTACACGACTCGAGTCGTGTAAGGTTTGTACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-341s1c1
Sequence:CCGGGCCTTTAGTCAGAGCATGAATCTCGAGATTCATGCTCTGACTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-1028s1c1
Sequence:CCGGGCTTACCTTATTGAACATCAACTCGAGTTGATGTTCAATAAGGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-152s1c1
Sequence:CCGGGAATGTAACCAGTGCAGCAAACTCGAGTTTGCTGCACTGGTTACATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-518s1c1
Sequence:CCGGCAAAGCATGAATTTGACAGTTCTCGAGAACTGTCAAATTCATGCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030613.2-637s21c1
Sequence:CCGGTGAGAGTATGTGGAGGTAATGCTCGAGCATTACCTCCACATACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030613.2-599s21c1
Sequence:CCGGCCAAGTGGGAGTTACCCATAACTCGAGTTATGGGTAACTCCCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030613.2-546s21c1
Sequence:CCGGGAAACCTGGGAACCTAATAATCTCGAGATTATTAGGTTCCCAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030613.2-1262s21c1
Sequence:CCGGCAGTCAAAGCATGCATCTTATCTCGAGATAAGATGCATGCTTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030613
ZFP2 MISSION shRNA Lentiviral Transduction Particles
ZFP2 zinc finger protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-1190s1c1
Sequence:CCGGCGGAGTACAAACCTTACACGACTCGAGTCGTGTAAGGTTTGTACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-341s1c1
Sequence:CCGGGCCTTTAGTCAGAGCATGAATCTCGAGATTCATGCTCTGACTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-1028s1c1
Sequence:CCGGGCTTACCTTATTGAACATCAACTCGAGTTGATGTTCAATAAGGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-152s1c1
Sequence:CCGGGAATGTAACCAGTGCAGCAAACTCGAGTTTGCTGCACTGGTTACATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030613.1-518s1c1
Sequence:CCGGCAAAGCATGAATTTGACAGTTCTCGAGAACTGTCAAATTCATGCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030613.2-637s21c1
Sequence:CCGGTGAGAGTATGTGGAGGTAATGCTCGAGCATTACCTCCACATACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030613.2-599s21c1
Sequence:CCGGCCAAGTGGGAGTTACCCATAACTCGAGTTATGGGTAACTCCCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030613.2-546s21c1
Sequence:CCGGGAAACCTGGGAACCTAATAATCTCGAGATTATTAGGTTCCCAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030613.2-1262s21c1
Sequence:CCGGCAGTCAAAGCATGCATCTTATCTCGAGATAAGATGCATGCTTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks