EMAIL THIS PAGE TO A FRIEND

ZFP30

ZFP30 zinc finger protein

Synonyms: ZNF745
UniProtKB ID: Q9Y2G7, Q58EY8
Gene ID:
Mouse(22693) zinc finger protein 30
Horse(100061970) zinc finger protein 30 homolog (mouse)
dog(100687072) zinc finger protein 30 homolog (mouse)
naked mole-rat(101697925) ZFP30 zinc finger protein
Domestic Rabbit(100352832) zinc finger protein 30 homolog (mouse)
cow(100124429) zinc finger protein 30 homolog (mouse)
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014898 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118951 MISSION® esiRNA esiRNA human ZFP30 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014898 Rosetta Predictions human pricing
NM_013705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346528 predicted 1302
2 SASI_Hs01_00150248 predicted 1717
3 SASI_Hs01_00150249 predicted 2154
4 SASI_Hs01_00150250 predicted 1801
5 SASI_Hs01_00150251 predicted 851
6 SASI_Hs01_00150253 predicted 842
7 SASI_Hs01_00150254 predicted 1173
8 SASI_Hs01_00150255 predicted 1558
9 SASI_Hs01_00150256 predicted 1074
10 SASI_Hs01_00150257 predicted 1306
11 SASI_Hs01_00150252 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138720 predicted 1795
2 SASI_Mm01_00138721 predicted 594
3 SASI_Mm01_00138722 predicted 1370
4 SASI_Mm01_00138723 predicted 1766
5 SASI_Mm01_00138724 predicted 1563
6 SASI_Mm01_00138725 predicted 1392
7 SASI_Mm01_00138726 predicted 1754
8 SASI_Mm01_00138727 predicted 1886
9 SASI_Mm01_00138728 predicted 1723
10 SASI_Mm01_00138729 predicted 1414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014898
ZFP30 MISSION shRNA Bacterial Glycerol Stock
ZFP30 zinc finger protein
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014898.1-2769s1c1
Sequence:CCGGCCTCCTAATGTGCTACAGTAACTCGAGTTACTGTAGCACATTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014898.1-1066s1c1
Sequence:CCGGCGACAACAACTTACTTTCCATCTCGAGATGGAAAGTAAGTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014898.1-1061s1c1
Sequence:CCGGGAGTACGACAACAACTTACTTCTCGAGAAGTAAGTTGTTGTCGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014898.1-1732s1c1
Sequence:CCGGCGTCGTTACTCAGAACTTATTCTCGAGAATAAGTTCTGAGTAACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014898.1-1306s1c1
Sequence:CCGGGCCTTTAGAGTTAGAGGACAACTCGAGTTGTCCTCTAACTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014898.2-2128s21c1
Sequence:CCGGGAACTCTTCCTTTGCGAATTTCTCGAGAAATTCGCAAAGGAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014898
ZFP30 MISSION shRNA shRNA Plasmid DNA
ZFP30 zinc finger protein
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014898.1-2769s1c1
Sequence:CCGGCCTCCTAATGTGCTACAGTAACTCGAGTTACTGTAGCACATTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014898.1-1066s1c1
Sequence:CCGGCGACAACAACTTACTTTCCATCTCGAGATGGAAAGTAAGTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014898.1-1061s1c1
Sequence:CCGGGAGTACGACAACAACTTACTTCTCGAGAAGTAAGTTGTTGTCGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014898.1-1732s1c1
Sequence:CCGGCGTCGTTACTCAGAACTTATTCTCGAGAATAAGTTCTGAGTAACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014898.1-1306s1c1
Sequence:CCGGGCCTTTAGAGTTAGAGGACAACTCGAGTTGTCCTCTAACTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014898.2-2128s21c1
Sequence:CCGGGAACTCTTCCTTTGCGAATTTCTCGAGAAATTCGCAAAGGAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014898
ZFP30 MISSION shRNA Lentiviral Transduction Particles
ZFP30 zinc finger protein
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014898.1-2769s1c1
Sequence:CCGGCCTCCTAATGTGCTACAGTAACTCGAGTTACTGTAGCACATTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014898.1-1066s1c1
Sequence:CCGGCGACAACAACTTACTTTCCATCTCGAGATGGAAAGTAAGTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014898.1-1061s1c1
Sequence:CCGGGAGTACGACAACAACTTACTTCTCGAGAAGTAAGTTGTTGTCGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014898.1-1732s1c1
Sequence:CCGGCGTCGTTACTCAGAACTTATTCTCGAGAATAAGTTCTGAGTAACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014898.1-1306s1c1
Sequence:CCGGGCCTTTAGAGTTAGAGGACAACTCGAGTTGTCCTCTAACTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014898.2-2128s21c1
Sequence:CCGGGAACTCTTCCTTTGCGAATTTCTCGAGAAATTCGCAAAGGAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013705
ZFP30 MISSION shRNA Bacterial Glycerol Stock
ZFP30 zinc finger protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013705.1-2421s1c1
Sequence:CCGGGCCATGATAGACTGGCTTGTACTCGAGTACAAGCCAGTCTATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013705.1-188s1c1
Sequence:CCGGCATGGCTCATAGTACGGTGATCTCGAGATCACCGTACTATGAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013705.1-493s1c1
Sequence:CCGGCGTGGGAAATAATGGGAAGAACTCGAGTTCTTCCCATTATTTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013705.1-660s1c1
Sequence:CCGGCCTGTTAGTCTCTATCAGAAACTCGAGTTTCTGATAGAGACTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013705.1-726s1c1
Sequence:CCGGGCTTTCAAAGTCCGCCAACAACTCGAGTTGTTGGCGGACTTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013705.1-2275s21c1
Sequence:CCGGGATTCGCATTATGATCCATTACTCGAGTAATGGATCATAATGCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013705.1-584s21c1
Sequence:CCGGGAACTCTCATAGGGTATATTTCTCGAGAAATATACCCTATGAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013705.1-2119s21c1
Sequence:CCGGCAGAATCACGCAGAGTCATATCTCGAGATATGACTCTGCGTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013705.1-1938s21c1
Sequence:CCGGTTGGAAATTCTTTCGTAAATGCTCGAGCATTTACGAAAGAATTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013705
ZFP30 MISSION shRNA shRNA Plasmid DNA
ZFP30 zinc finger protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013705.1-2421s1c1
Sequence:CCGGGCCATGATAGACTGGCTTGTACTCGAGTACAAGCCAGTCTATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013705.1-188s1c1
Sequence:CCGGCATGGCTCATAGTACGGTGATCTCGAGATCACCGTACTATGAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013705.1-493s1c1
Sequence:CCGGCGTGGGAAATAATGGGAAGAACTCGAGTTCTTCCCATTATTTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013705.1-660s1c1
Sequence:CCGGCCTGTTAGTCTCTATCAGAAACTCGAGTTTCTGATAGAGACTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013705.1-726s1c1
Sequence:CCGGGCTTTCAAAGTCCGCCAACAACTCGAGTTGTTGGCGGACTTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013705.1-2275s21c1
Sequence:CCGGGATTCGCATTATGATCCATTACTCGAGTAATGGATCATAATGCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013705.1-584s21c1
Sequence:CCGGGAACTCTCATAGGGTATATTTCTCGAGAAATATACCCTATGAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013705.1-2119s21c1
Sequence:CCGGCAGAATCACGCAGAGTCATATCTCGAGATATGACTCTGCGTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013705.1-1938s21c1
Sequence:CCGGTTGGAAATTCTTTCGTAAATGCTCGAGCATTTACGAAAGAATTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013705
ZFP30 MISSION shRNA Lentiviral Transduction Particles
ZFP30 zinc finger protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013705.1-2421s1c1
Sequence:CCGGGCCATGATAGACTGGCTTGTACTCGAGTACAAGCCAGTCTATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013705.1-188s1c1
Sequence:CCGGCATGGCTCATAGTACGGTGATCTCGAGATCACCGTACTATGAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013705.1-493s1c1
Sequence:CCGGCGTGGGAAATAATGGGAAGAACTCGAGTTCTTCCCATTATTTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013705.1-660s1c1
Sequence:CCGGCCTGTTAGTCTCTATCAGAAACTCGAGTTTCTGATAGAGACTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013705.1-726s1c1
Sequence:CCGGGCTTTCAAAGTCCGCCAACAACTCGAGTTGTTGGCGGACTTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013705.1-2275s21c1
Sequence:CCGGGATTCGCATTATGATCCATTACTCGAGTAATGGATCATAATGCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013705.1-584s21c1
Sequence:CCGGGAACTCTCATAGGGTATATTTCTCGAGAAATATACCCTATGAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013705.1-2119s21c1
Sequence:CCGGCAGAATCACGCAGAGTCATATCTCGAGATATGACTCTGCGTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013705.1-1938s21c1
Sequence:CCGGTTGGAAATTCTTTCGTAAATGCTCGAGCATTTACGAAAGAATTTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks