EMAIL THIS PAGE TO A FRIEND

ZFP36

ZFP36 ring finger protein

Synonyms: G0S24 GOS24 NUP475 RNF162A TIS11 TTP zfp-36
UniProtKB ID: P26651, B2RA54
Gene ID:
Mouse(22695) zinc finger protein 36
Rat(79426) zinc finger protein 36
cow(282127) zinc finger protein 36, C3H type, homolog (mouse)
sheep(443283) zinc finger protein 36, C3H type, homolog (mouse)
domestic guinea pig(100733110) ZFP36 ring finger protein
naked mole-rat(101697183) ZFP36 ring finger protein
dog(484510) zinc finger protein 36, C3H type, homolog (mouse)
domestic cat(101096862) zinc finger protein 36, C3H type, homolog (mouse)
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003407 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003407 Rosetta Predictions human pricing
NM_133290 Rosetta Predictions rat pricing
NM_011756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335603 predicted 323
2 SASI_Hs01_00030373 predicted 372
3 SASI_Hs01_00030376 predicted 362
4 SASI_Hs02_00335604 predicted 323
5 SASI_Hs01_00030378 predicted 372
6 SASI_Hs02_00335605 predicted 584
7 SASI_Hs02_00335606 predicted 374
8 SASI_Hs02_00335607 predicted 593
9 SASI_Hs02_00335608 predicted 545
10 SASI_Hs02_00335609 predicted 369
11 SASI_Hs01_00030369 predicted 1047
12 SASI_Hs01_00030370 predicted 487
13 SASI_Hs01_00030371 predicted 493
14 SASI_Hs01_00030372 predicted 948
15 SASI_Hs01_00030374 predicted 937
16 SASI_Hs01_00030375 predicted 322
17 SASI_Hs01_00030377 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062133 predicted 1399
2 SASI_Rn01_00062134 predicted 1030
3 SASI_Rn01_00062135 predicted 1323
4 SASI_Rn01_00062136 predicted 1057
5 SASI_Rn01_00062137 predicted 1388
6 SASI_Rn01_00062138 predicted 1120
7 SASI_Rn01_00062140 predicted 1440
8 SASI_Rn01_00062141 predicted 1185
9 SASI_Rn01_00062142 predicted 1500
10 SASI_Rn02_00267575 predicted 301
11 SASI_Rn01_00062139 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178605 predicted 1293
2 SASI_Mm01_00178606 predicted 1006
3 SASI_Mm02_00321352 predicted 1374
4 SASI_Mm01_00178608 predicted 1415
5 SASI_Mm02_00321353 predicted 1367
6 SASI_Mm01_00178609 predicted 1164
7 SASI_Mm01_00178610 predicted 1474
8 SASI_Mm01_00178611 predicted 992
9 SASI_Mm01_00178613 predicted 1266
10 SASI_Mm02_00321354 predicted 258
11 SASI_Mm01_00178607 predicted 1380
12 SASI_Mm01_00178612 predicted 1495
13 SASI_Mm01_00178614 predicted 281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011756
VALIDATED
ZFP36 MISSION shRNA Bacterial Glycerol Stock
ZFP36 ring finger protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011756.3-1559s1c1
Sequence:CCGGGCCCTTTATTTATGACGACTTCTCGAGAAGTCGTCATAAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011756.3-846s1c1
Sequence:CCGGCCGATCCTGATGACTACGCCACTCGAGTGGCGTAGTCATCAGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011756.3-724s1c1
Sequence:CCGGTGTGACTCGAAGAGACCCTAACTCGAGTTAGGGTCTCTTCGAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011756.3-112s1c1
Sequence:CCGGCGGAGGACTTTGGAACATAAACTCGAGTTTATGTTCCAAAGTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011756.3-547s1c1
Sequence:CCGGGCTGCGACAAAGCATCAGCTTCTCGAGAAGCTGATGCTTTGTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011756.4-1110s21c1
Sequence:CCGGCCAAGATGCAATAACCCATTTCTCGAGAAATGGGTTATTGCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011756.4-986s21c1
Sequence:CCGGGAGTGACAAGTGCCTACCTACCTCGAGGTAGGTAGGCACTTGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011756.4-264s21c1
Sequence:CCGGAGCTGTCACCCTCACCTACTTCTCGAGAAGTAGGTGAGGGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011756.4-888s21c1
Sequence:CCGGGGTCAGACTCACCTGTCTTTGCTCGAGCAAAGACAGGTGAGTCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011756.4-302s21c1
Sequence:CCGGACCACCTCCTCTCGATACAAGCTCGAGCTTGTATCGAGAGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011756
VALIDATED
ZFP36 MISSION shRNA shRNA Plasmid DNA
ZFP36 ring finger protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011756.3-1559s1c1
Sequence:CCGGGCCCTTTATTTATGACGACTTCTCGAGAAGTCGTCATAAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011756.3-846s1c1
Sequence:CCGGCCGATCCTGATGACTACGCCACTCGAGTGGCGTAGTCATCAGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011756.3-724s1c1
Sequence:CCGGTGTGACTCGAAGAGACCCTAACTCGAGTTAGGGTCTCTTCGAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011756.3-112s1c1
Sequence:CCGGCGGAGGACTTTGGAACATAAACTCGAGTTTATGTTCCAAAGTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011756.3-547s1c1
Sequence:CCGGGCTGCGACAAAGCATCAGCTTCTCGAGAAGCTGATGCTTTGTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011756.4-1110s21c1
Sequence:CCGGCCAAGATGCAATAACCCATTTCTCGAGAAATGGGTTATTGCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011756.4-986s21c1
Sequence:CCGGGAGTGACAAGTGCCTACCTACCTCGAGGTAGGTAGGCACTTGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011756.4-264s21c1
Sequence:CCGGAGCTGTCACCCTCACCTACTTCTCGAGAAGTAGGTGAGGGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011756.4-888s21c1
Sequence:CCGGGGTCAGACTCACCTGTCTTTGCTCGAGCAAAGACAGGTGAGTCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011756.4-302s21c1
Sequence:CCGGACCACCTCCTCTCGATACAAGCTCGAGCTTGTATCGAGAGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011756
VALIDATED
ZFP36 MISSION shRNA Lentiviral Transduction Particles
ZFP36 ring finger protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011756.3-1559s1c1
Sequence:CCGGGCCCTTTATTTATGACGACTTCTCGAGAAGTCGTCATAAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011756.3-846s1c1
Sequence:CCGGCCGATCCTGATGACTACGCCACTCGAGTGGCGTAGTCATCAGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011756.3-724s1c1
Sequence:CCGGTGTGACTCGAAGAGACCCTAACTCGAGTTAGGGTCTCTTCGAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011756.3-112s1c1
Sequence:CCGGCGGAGGACTTTGGAACATAAACTCGAGTTTATGTTCCAAAGTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011756.3-547s1c1
Sequence:CCGGGCTGCGACAAAGCATCAGCTTCTCGAGAAGCTGATGCTTTGTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011756.4-1110s21c1
Sequence:CCGGCCAAGATGCAATAACCCATTTCTCGAGAAATGGGTTATTGCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011756.4-986s21c1
Sequence:CCGGGAGTGACAAGTGCCTACCTACCTCGAGGTAGGTAGGCACTTGTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011756.4-264s21c1
Sequence:CCGGAGCTGTCACCCTCACCTACTTCTCGAGAAGTAGGTGAGGGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011756.4-888s21c1
Sequence:CCGGGGTCAGACTCACCTGTCTTTGCTCGAGCAAAGACAGGTGAGTCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011756.4-302s21c1
Sequence:CCGGACCACCTCCTCTCGATACAAGCTCGAGCTTGTATCGAGAGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003407
ZFP36 MISSION shRNA Bacterial Glycerol Stock
ZFP36 ring finger protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003407.1-599s1c1
Sequence:CCGGGCTTCGCCAGAGCATCAGCTTCTCGAGAAGCTGATGCTCTGGCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003407.1-366s1c1
Sequence:CCGGCGCTACAAGACTGAGCTATGTCTCGAGACATAGCTCAGTCTTGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003407.1-1528s1c1
Sequence:CCGGCCCTTTATTTATGACGACTTTCTCGAGAAAGTCGTCATAAATAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003407.1-1008s1c1
Sequence:CCGGCCCATCTTCAATCGCATCTCTCTCGAGAGAGATGCGATTGAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003407.1-488s1c1
Sequence:CCGGGACGGAACTCTGTCACAAGTTCTCGAGAACTTGTGACAGAGTTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003407.2-550s21c1
Sequence:CCGGCATCCACAACCCTAGCGAAGACTCGAGTCTTCGCTAGGGTTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003407.2-891s21c1
Sequence:CCGGGATCCGACCCTGATGAATATGCTCGAGCATATTCATCAGGGTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003407.2-1339s21c1
Sequence:CCGGATCTGTCTCCTAGAATCTTATCTCGAGATAAGATTCTAGGAGACAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003407
ZFP36 MISSION shRNA shRNA Plasmid DNA
ZFP36 ring finger protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003407.1-599s1c1
Sequence:CCGGGCTTCGCCAGAGCATCAGCTTCTCGAGAAGCTGATGCTCTGGCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003407.1-366s1c1
Sequence:CCGGCGCTACAAGACTGAGCTATGTCTCGAGACATAGCTCAGTCTTGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003407.1-1528s1c1
Sequence:CCGGCCCTTTATTTATGACGACTTTCTCGAGAAAGTCGTCATAAATAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003407.1-1008s1c1
Sequence:CCGGCCCATCTTCAATCGCATCTCTCTCGAGAGAGATGCGATTGAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003407.1-488s1c1
Sequence:CCGGGACGGAACTCTGTCACAAGTTCTCGAGAACTTGTGACAGAGTTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003407.2-550s21c1
Sequence:CCGGCATCCACAACCCTAGCGAAGACTCGAGTCTTCGCTAGGGTTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003407.2-891s21c1
Sequence:CCGGGATCCGACCCTGATGAATATGCTCGAGCATATTCATCAGGGTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003407.2-1339s21c1
Sequence:CCGGATCTGTCTCCTAGAATCTTATCTCGAGATAAGATTCTAGGAGACAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003407
ZFP36 MISSION shRNA Lentiviral Transduction Particles
ZFP36 ring finger protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003407.1-599s1c1
Sequence:CCGGGCTTCGCCAGAGCATCAGCTTCTCGAGAAGCTGATGCTCTGGCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003407.1-366s1c1
Sequence:CCGGCGCTACAAGACTGAGCTATGTCTCGAGACATAGCTCAGTCTTGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003407.1-1528s1c1
Sequence:CCGGCCCTTTATTTATGACGACTTTCTCGAGAAAGTCGTCATAAATAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003407.1-1008s1c1
Sequence:CCGGCCCATCTTCAATCGCATCTCTCTCGAGAGAGATGCGATTGAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003407.1-488s1c1
Sequence:CCGGGACGGAACTCTGTCACAAGTTCTCGAGAACTTGTGACAGAGTTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003407.2-550s21c1
Sequence:CCGGCATCCACAACCCTAGCGAAGACTCGAGTCTTCGCTAGGGTTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003407.2-891s21c1
Sequence:CCGGGATCCGACCCTGATGAATATGCTCGAGCATATTCATCAGGGTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003407.2-1339s21c1
Sequence:CCGGATCTGTCTCCTAGAATCTTATCTCGAGATAAGATTCTAGGAGACAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks