EMAIL THIS PAGE TO A FRIEND

ZFP36L1

ZFP36 ring finger protein-like 1

Synonyms: BRF1 Berg36 ERF-1 ERF1 RNF162B TIS11B cMG1
UniProtKB ID: Q07352, Q13851
Gene ID:
Human(677) Summary: This gene is a member of the TIS11 family of early response genes, which are induced by various agonists such as the phorbol ester TPA and the polypeptide mitogen EGF. This gene is well conserved across species and has a promoter that contains motifs seen in other early-response genes. The encoded protein contains a distinguishing putative zinc finger domain with a repeating cys-his motif. This putative nuclear transcription factor most likely functions in regulating the response to growth factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(12192) zinc finger protein 36, C3H type-like 1
Rat(29344) zinc finger protein 36, C3H type-like 1
cow(614773) zinc finger protein 36, C3H type-like 1
sheep(101121684) zinc finger protein 36, C3H type-like 1
domestic guinea pig(100721072) ZFP36 ring finger protein-like 1
naked mole-rat(101712905) ZFP36 ring finger protein-like 1
Domestic Rabbit(100350146) zinc finger protein 36, C3H type-like 1
chicken(101669644) ZFP36 ring finger protein-like 1
dog(490748) zinc finger protein 36, C3H type-like 1
Horse(100063663) zinc finger protein 36, C3H type-like 1
domestic cat(101097563) zinc finger protein 36, C3H type-like 1
chicken(101751828) ZFP36 ring finger protein-like 1
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004926 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004926 Rosetta Predictions human pricing
NM_017172 Rosetta Predictions rat pricing
NM_007564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129766 predicted 1117
2 SASI_Hs02_00338592 predicted 1193
3 SASI_Hs01_00129767 predicted 1123
4 SASI_Hs01_00129768 predicted 196
5 SASI_Hs01_00129769 predicted 354
6 SASI_Hs01_00129770 predicted 298
7 SASI_Hs01_00129771 predicted 373
8 SASI_Hs01_00129772 predicted 1011
9 SASI_Hs01_00129773 predicted 453
10 SASI_Hs01_00129774 predicted 283
11 SASI_Hs01_00129775 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065032 predicted 1104
2 SASI_Rn01_00065033 predicted 358
3 SASI_Rn01_00065034 predicted 887
4 SASI_Rn01_00065035 predicted 440
5 SASI_Rn01_00065036 predicted 280
6 SASI_Rn01_00065037 predicted 811
7 SASI_Rn01_00065038 predicted 706
8 SASI_Rn01_00065039 predicted 434
9 SASI_Rn01_00065040 predicted 811
10 SASI_Rn01_00065041 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063508 predicted 843
2 SASI_Mm01_00063509 predicted 382
3 SASI_Mm01_00063510 predicted 837
4 SASI_Mm01_00063511 predicted 388
5 SASI_Mm01_00063512 predicted 910
6 SASI_Mm01_00063513 predicted 854
7 SASI_Mm01_00063514 predicted 738
8 SASI_Mm01_00063515 predicted 380
9 SASI_Mm01_00063516 predicted 461
10 SASI_Mm01_00063517 predicted 735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007564
VALIDATED
ZFP36L1 MISSION shRNA Bacterial Glycerol Stock
ZFP36 ring finger protein-like 1
Mouse
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-195s21c1
Sequence:CCGGGGGTAACAAGATGCTCAACTACTCGAGTAGTTGAGCATCTTGTTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-391s21c1
Sequence:CCGGCGCTTTCGAGACCGCTCTTTCCTCGAGGAAAGAGCGGTCTCGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-916s21c1
Sequence:CCGGAGCCTCTTTGCTCCTAGCATGCTCGAGCATGCTAGGAGCAAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-651s21c1
Sequence:CCGGCCGCTGCCACTTCATTCATAACTCGAGTTATGAATGAAGTGGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007564.5-1136s21c1
Sequence:CCGGTCTCCATCTCAGATGACTAAGCTCGAGCTTAGTCATCTGAGATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007564.5-334s21c1
Sequence:CCGGCAGCTTCTCAGCAGCCTTAAGCTCGAGCTTAAGGCTGCTGAGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-864s21c1
Sequence:CCGGTCTGCCCGATGGCACCAATAACTCGAGTTATTGGTGCCATCGGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007564.5-2758s21c1
Sequence:CCGGAGACATTCCGCTCGCAGATTTCTCGAGAAATCTGCGAGCGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007564.5-494s21c1
Sequence:CCGGTGTGCCGTCCCTTCGAAGAAACTCGAGTTTCTTCGAAGGGACGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-1023s21c1
Sequence:CCGGTCAGGATTCTCTCTCGGACCACTCGAGTGGTCCGAGAGAGAATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-1092s21c1
Sequence:CCGGCCCTACCTTGGACAACTCAAGCTCGAGCTTGAGTTGTCCAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-725s21c1
Sequence:CCGGCCCGCCTCCAGCATAGCTTTACTCGAGTAAAGCTATGCTGGAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007564.2-2100s1c1
Sequence:CCGGCCACATACAATATCTGTGTAACTCGAGTTACACAGATATTGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007564.2-313s1c1
Sequence:CCGGCAGCTCCAAGTTCCATCAGAACTCGAGTTCTGATGGAACTTGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007564.2-193s1c1
Sequence:CCGGCAAGGGTAACAAGATGCTCAACTCGAGTTGAGCATCTTGTTACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007564.2-652s1c1
Sequence:CCGGCCGCTGCCACTTCATTCATAACTCGAGTTATGAATGAAGTGGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007564.2-731s1c1
Sequence:CCGGCTCCAGCATAGCTTTAGCTTTCTCGAGAAAGCTAAAGCTATGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007564
VALIDATED
ZFP36L1 MISSION shRNA shRNA Plasmid DNA
ZFP36 ring finger protein-like 1
Mouse
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-195s21c1
Sequence:CCGGGGGTAACAAGATGCTCAACTACTCGAGTAGTTGAGCATCTTGTTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-391s21c1
Sequence:CCGGCGCTTTCGAGACCGCTCTTTCCTCGAGGAAAGAGCGGTCTCGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-916s21c1
Sequence:CCGGAGCCTCTTTGCTCCTAGCATGCTCGAGCATGCTAGGAGCAAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-651s21c1
Sequence:CCGGCCGCTGCCACTTCATTCATAACTCGAGTTATGAATGAAGTGGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007564.5-1136s21c1
Sequence:CCGGTCTCCATCTCAGATGACTAAGCTCGAGCTTAGTCATCTGAGATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007564.5-334s21c1
Sequence:CCGGCAGCTTCTCAGCAGCCTTAAGCTCGAGCTTAAGGCTGCTGAGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-864s21c1
Sequence:CCGGTCTGCCCGATGGCACCAATAACTCGAGTTATTGGTGCCATCGGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007564.5-2758s21c1
Sequence:CCGGAGACATTCCGCTCGCAGATTTCTCGAGAAATCTGCGAGCGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007564.5-494s21c1
Sequence:CCGGTGTGCCGTCCCTTCGAAGAAACTCGAGTTTCTTCGAAGGGACGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-1023s21c1
Sequence:CCGGTCAGGATTCTCTCTCGGACCACTCGAGTGGTCCGAGAGAGAATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-1092s21c1
Sequence:CCGGCCCTACCTTGGACAACTCAAGCTCGAGCTTGAGTTGTCCAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-725s21c1
Sequence:CCGGCCCGCCTCCAGCATAGCTTTACTCGAGTAAAGCTATGCTGGAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007564.2-2100s1c1
Sequence:CCGGCCACATACAATATCTGTGTAACTCGAGTTACACAGATATTGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007564.2-313s1c1
Sequence:CCGGCAGCTCCAAGTTCCATCAGAACTCGAGTTCTGATGGAACTTGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007564.2-193s1c1
Sequence:CCGGCAAGGGTAACAAGATGCTCAACTCGAGTTGAGCATCTTGTTACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007564.2-652s1c1
Sequence:CCGGCCGCTGCCACTTCATTCATAACTCGAGTTATGAATGAAGTGGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007564.2-731s1c1
Sequence:CCGGCTCCAGCATAGCTTTAGCTTTCTCGAGAAAGCTAAAGCTATGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007564
VALIDATED
ZFP36L1 MISSION shRNA Lentiviral Transduction Particles
ZFP36 ring finger protein-like 1
Mouse
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-195s21c1
Sequence:CCGGGGGTAACAAGATGCTCAACTACTCGAGTAGTTGAGCATCTTGTTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-391s21c1
Sequence:CCGGCGCTTTCGAGACCGCTCTTTCCTCGAGGAAAGAGCGGTCTCGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-916s21c1
Sequence:CCGGAGCCTCTTTGCTCCTAGCATGCTCGAGCATGCTAGGAGCAAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-651s21c1
Sequence:CCGGCCGCTGCCACTTCATTCATAACTCGAGTTATGAATGAAGTGGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007564.5-1136s21c1
Sequence:CCGGTCTCCATCTCAGATGACTAAGCTCGAGCTTAGTCATCTGAGATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007564.5-334s21c1
Sequence:CCGGCAGCTTCTCAGCAGCCTTAAGCTCGAGCTTAAGGCTGCTGAGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-864s21c1
Sequence:CCGGTCTGCCCGATGGCACCAATAACTCGAGTTATTGGTGCCATCGGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007564.5-2758s21c1
Sequence:CCGGAGACATTCCGCTCGCAGATTTCTCGAGAAATCTGCGAGCGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007564.5-494s21c1
Sequence:CCGGTGTGCCGTCCCTTCGAAGAAACTCGAGTTTCTTCGAAGGGACGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-1023s21c1
Sequence:CCGGTCAGGATTCTCTCTCGGACCACTCGAGTGGTCCGAGAGAGAATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-1092s21c1
Sequence:CCGGCCCTACCTTGGACAACTCAAGCTCGAGCTTGAGTTGTCCAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007564.5-725s21c1
Sequence:CCGGCCCGCCTCCAGCATAGCTTTACTCGAGTAAAGCTATGCTGGAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007564.2-2100s1c1
Sequence:CCGGCCACATACAATATCTGTGTAACTCGAGTTACACAGATATTGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007564.2-313s1c1
Sequence:CCGGCAGCTCCAAGTTCCATCAGAACTCGAGTTCTGATGGAACTTGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007564.2-193s1c1
Sequence:CCGGCAAGGGTAACAAGATGCTCAACTCGAGTTGAGCATCTTGTTACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007564.2-652s1c1
Sequence:CCGGCCGCTGCCACTTCATTCATAACTCGAGTTATGAATGAAGTGGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007564.2-731s1c1
Sequence:CCGGCTCCAGCATAGCTTTAGCTTTCTCGAGAAAGCTAAAGCTATGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004926
VALIDATED
ZFP36L1 MISSION shRNA Bacterial Glycerol Stock
ZFP36 ring finger protein-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004926.2-1242s21c1
Sequence:CCGGCCCTACATTAACAAGGTTAAGCTCGAGCTTAACCTTGTTAATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004926.2-189s21c1
Sequence:CCGGGTAACAAGATGCTCAACTATACTCGAGTATAGTTGAGCATCTTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004926.2-721s21c1
Sequence:CCGGCCTCCAGCATAGCTTTAGCTTCTCGAGAAGCTAAAGCTATGCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004926.2-226s21c1
Sequence:CCGGGGGTTGCCTGCTGGACAGAAACTCGAGTTTCTGTCCAGCAGGCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004926.2-305s21c1
Sequence:CCGGAGCTCCAAGTTCCACCAGAACCTCGAGGTTCTGGTGGAACTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004926.2-159s1c1
Sequence:CCGGTCTTCGACTTGAGCGAAGTTTCTCGAGAAACTTCGCTCAAGTCGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004926.2-721s1c1
Sequence:CCGGCCTCCAGCATAGCTTTAGCTTCTCGAGAAGCTAAAGCTATGCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004926.2-189s1c1
Sequence:CCGGGTAACAAGATGCTCAACTATACTCGAGTATAGTTGAGCATCTTGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004926.2-1241s1c1
Sequence:CCGGGCCCTACATTAACAAGGTTAACTCGAGTTAACCTTGTTAATGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004926.2-862s1c1
Sequence:CCGGCGATGGCACCAATAACCCTTTCTCGAGAAAGGGTTATTGGTGCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004926
VALIDATED
ZFP36L1 MISSION shRNA shRNA Plasmid DNA
ZFP36 ring finger protein-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004926.2-1242s21c1
Sequence:CCGGCCCTACATTAACAAGGTTAAGCTCGAGCTTAACCTTGTTAATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004926.2-189s21c1
Sequence:CCGGGTAACAAGATGCTCAACTATACTCGAGTATAGTTGAGCATCTTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004926.2-721s21c1
Sequence:CCGGCCTCCAGCATAGCTTTAGCTTCTCGAGAAGCTAAAGCTATGCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004926.2-226s21c1
Sequence:CCGGGGGTTGCCTGCTGGACAGAAACTCGAGTTTCTGTCCAGCAGGCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004926.2-305s21c1
Sequence:CCGGAGCTCCAAGTTCCACCAGAACCTCGAGGTTCTGGTGGAACTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004926.2-159s1c1
Sequence:CCGGTCTTCGACTTGAGCGAAGTTTCTCGAGAAACTTCGCTCAAGTCGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004926.2-721s1c1
Sequence:CCGGCCTCCAGCATAGCTTTAGCTTCTCGAGAAGCTAAAGCTATGCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004926.2-189s1c1
Sequence:CCGGGTAACAAGATGCTCAACTATACTCGAGTATAGTTGAGCATCTTGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004926.2-1241s1c1
Sequence:CCGGGCCCTACATTAACAAGGTTAACTCGAGTTAACCTTGTTAATGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004926.2-862s1c1
Sequence:CCGGCGATGGCACCAATAACCCTTTCTCGAGAAAGGGTTATTGGTGCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004926
VALIDATED
ZFP36L1 MISSION shRNA Lentiviral Transduction Particles
ZFP36 ring finger protein-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004926.2-1242s21c1
Sequence:CCGGCCCTACATTAACAAGGTTAAGCTCGAGCTTAACCTTGTTAATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004926.2-189s21c1
Sequence:CCGGGTAACAAGATGCTCAACTATACTCGAGTATAGTTGAGCATCTTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004926.2-721s21c1
Sequence:CCGGCCTCCAGCATAGCTTTAGCTTCTCGAGAAGCTAAAGCTATGCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004926.2-226s21c1
Sequence:CCGGGGGTTGCCTGCTGGACAGAAACTCGAGTTTCTGTCCAGCAGGCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004926.2-305s21c1
Sequence:CCGGAGCTCCAAGTTCCACCAGAACCTCGAGGTTCTGGTGGAACTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004926.2-159s1c1
Sequence:CCGGTCTTCGACTTGAGCGAAGTTTCTCGAGAAACTTCGCTCAAGTCGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004926.2-721s1c1
Sequence:CCGGCCTCCAGCATAGCTTTAGCTTCTCGAGAAGCTAAAGCTATGCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004926.2-189s1c1
Sequence:CCGGGTAACAAGATGCTCAACTATACTCGAGTATAGTTGAGCATCTTGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004926.2-1241s1c1
Sequence:CCGGGCCCTACATTAACAAGGTTAACTCGAGTTAACCTTGTTAATGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004926.2-862s1c1
Sequence:CCGGCGATGGCACCAATAACCCTTTCTCGAGAAAGGGTTATTGGTGCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks