EMAIL THIS PAGE TO A FRIEND

ZFP36L2

ZFP36 ring finger protein-like 2

Synonyms: BRF2 ERF-2 ERF2 RNF162C TIS11D
UniProtKB ID: P47974, Q53TB4, Q9BSJ3
Gene ID:
Human(678) Summary: This gene is a member of the TIS11 family of early response genes. Family members are induced by various agonists such as the phorbol ester TPA and the polypeptide mitogen EGF. The encoded protein contains a distinguishing putative zinc finger domain with a repeating cys-his motif. This putative nuclear transcription factor most likely functions in regulating the response to growth factors. [provided by RefSeq, Jul 2008]
Mouse(12193) zinc finger protein 36, C3H type-like 2
Rat(298765) zinc finger protein 36, C3H type-like 2
Zebrafish(333941) zinc finger protein 36, C3H type-like 2
domestic cat(101098532) zinc finger protein 36, C3H type-like 2
Horse(100057924) zinc finger protein 36, C3H type-like 2
dog(609810) zinc finger protein 36, C3H type-like 2
naked mole-rat(101718507) ZFP36 ring finger protein-like 2
domestic guinea pig(100724488) ZFP36 ring finger protein-like 2
cow(767898) zinc finger protein 36, C3H type-like 2
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006887 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU154331 MISSION® esiRNA esiRNA targeting mouse Zfp36l2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006887 Rosetta Predictions human pricing
NM_001036626 Rosetta Predictions rat pricing
XM_001060793 Rosetta Predictions rat pricing
NM_001001806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137703 predicted 307
2 SASI_Hs01_00137706 predicted 356
3 SASI_Hs01_00137708 predicted 576
4 SASI_Hs01_00137709 predicted 456
5 SASI_Hs02_00342549 predicted 438
6 SASI_Hs02_00342550 predicted 2230
7 SASI_Hs02_00342551 predicted 882
8 SASI_Hs02_00342552 predicted 1776
9 SASI_Hs02_00342553 predicted 2225
10 SASI_Hs02_00342554 predicted 2188
11 SASI_Hs01_00137701 predicted 577
12 SASI_Hs01_00137702 predicted 727
13 SASI_Hs01_00137704 predicted 649
14 SASI_Hs01_00137705 predicted 726
15 SASI_Hs01_00137707 predicted 646
16 SASI_Hs01_00137710 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001036626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121005 predicted 571
2 SASI_Rn01_00121006 predicted 248
3 SASI_Rn01_00121007 predicted 245
4 SASI_Rn02_00204213 predicted 284
5 SASI_Rn01_00121009 predicted 2173
6 SASI_Rn01_00121011 predicted 2170
7 SASI_Rn02_00204214 predicted 1971
8 SASI_Rn01_00121012 predicted 2059
9 SASI_Rn01_00121013 predicted 2093
10 SASI_Rn01_00121014 predicted 2065
11 SASI_Rn01_00121008 predicted 559
12 SASI_Rn01_00121010 predicted 1348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297741 predicted 869
2 SASI_Rn02_00297742 predicted 545
3 SASI_Rn02_00297743 predicted 541
4 SASI_Rn02_00297744 predicted 576
5 SASI_Rn02_00297745 predicted 2186
6 SASI_Rn02_00297746 predicted 2194
7 SASI_Rn02_00297747 predicted 1987
8 SASI_Rn02_00297748 predicted 2078
9 SASI_Rn02_00297749 predicted 2117
10 SASI_Rn02_00297750 predicted 1967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086684 predicted 260
2 SASI_Mm01_00086685 predicted 275
3 SASI_Mm01_00086686 predicted 2180
4 SASI_Mm02_00286215 predicted 2101
5 SASI_Mm02_00286216 predicted 2105
6 SASI_Mm01_00086687 predicted 316
7 SASI_Mm02_00286217 predicted 2114
8 SASI_Mm01_00086689 predicted 2183
9 SASI_Mm01_00086690 predicted 540
10 SASI_Mm02_00286218 predicted 2098
11 SASI_Mm01_00086682 predicted 260
12 SASI_Mm01_00086683 predicted 301
13 SASI_Mm01_00086688 predicted 600
14 SASI_Mm01_00086691 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006887
ZFP36L2 MISSION shRNA Bacterial Glycerol Stock
ZFP36 ring finger protein-like 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006887.3-2291s1c1
Sequence:CCGGGCCACCTTGCTAAACCTATAACTCGAGTTATAGGTTTAGCAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006887.3-330s1c1
Sequence:CCGGCTTCTTGTGCAAGACAGAGAACTCGAGTTCTCTGTCTTGCACAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006887.3-788s1c1
Sequence:CCGGGCACGTGCAAGTACGGCGAAACTCGAGTTTCGCCGTACTTGCACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006887.3-1416s1c1
Sequence:CCGGGCTCGCCATCCAGACCCACAACTCGAGTTGTGGGTCTGGATGGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006887.3-627s1c1
Sequence:CCGGGCTCAACAAGGAGAACAAATTCTCGAGAATTTGTTCTCCTTGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006887.4-736s21c1
Sequence:CCGGATCAACTCCACGCGCTACAAGCTCGAGCTTGTAGCGCGTGGAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006887
ZFP36L2 MISSION shRNA shRNA Plasmid DNA
ZFP36 ring finger protein-like 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006887.3-2291s1c1
Sequence:CCGGGCCACCTTGCTAAACCTATAACTCGAGTTATAGGTTTAGCAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006887.3-330s1c1
Sequence:CCGGCTTCTTGTGCAAGACAGAGAACTCGAGTTCTCTGTCTTGCACAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006887.3-788s1c1
Sequence:CCGGGCACGTGCAAGTACGGCGAAACTCGAGTTTCGCCGTACTTGCACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006887.3-1416s1c1
Sequence:CCGGGCTCGCCATCCAGACCCACAACTCGAGTTGTGGGTCTGGATGGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006887.3-627s1c1
Sequence:CCGGGCTCAACAAGGAGAACAAATTCTCGAGAATTTGTTCTCCTTGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006887.4-736s21c1
Sequence:CCGGATCAACTCCACGCGCTACAAGCTCGAGCTTGTAGCGCGTGGAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006887
ZFP36L2 MISSION shRNA Lentiviral Transduction Particles
ZFP36 ring finger protein-like 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006887.3-2291s1c1
Sequence:CCGGGCCACCTTGCTAAACCTATAACTCGAGTTATAGGTTTAGCAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006887.3-330s1c1
Sequence:CCGGCTTCTTGTGCAAGACAGAGAACTCGAGTTCTCTGTCTTGCACAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006887.3-788s1c1
Sequence:CCGGGCACGTGCAAGTACGGCGAAACTCGAGTTTCGCCGTACTTGCACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006887.3-1416s1c1
Sequence:CCGGGCTCGCCATCCAGACCCACAACTCGAGTTGTGGGTCTGGATGGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006887.3-627s1c1
Sequence:CCGGGCTCAACAAGGAGAACAAATTCTCGAGAATTTGTTCTCCTTGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006887.4-736s21c1
Sequence:CCGGATCAACTCCACGCGCTACAAGCTCGAGCTTGTAGCGCGTGGAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001806
VALIDATED
ZFP36L2 MISSION shRNA Bacterial Glycerol Stock
ZFP36 ring finger protein-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001806.1-319s1c1
Sequence:CCGGCAAACCTCAATCTGAACAACACTCGAGTGTTGTTCAGATTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001001806.2-2497s1c1
Sequence:CCGGGCACCACAACTCAATATGAAACTCGAGTTTCATATTGAGTTGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001001806.2-2812s1c1
Sequence:CCGGCGCATGAAGAAACCATGCAATCTCGAGATTGCATGGTTTCTTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001001806.2-3208s1c1
Sequence:CCGGGCTGAAATGTTGGTGGTACATCTCGAGATGTACCACCAACATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173172    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001001806.2-2003s1c1
Sequence:CCGGCCAAACACTTAGGTCTCAGATCTCGAGATCTGAGACCTAAGTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001806
VALIDATED
ZFP36L2 MISSION shRNA shRNA Plasmid DNA
ZFP36 ring finger protein-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001806.1-319s1c1
Sequence:CCGGCAAACCTCAATCTGAACAACACTCGAGTGTTGTTCAGATTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001001806.2-2497s1c1
Sequence:CCGGGCACCACAACTCAATATGAAACTCGAGTTTCATATTGAGTTGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001001806.2-2812s1c1
Sequence:CCGGCGCATGAAGAAACCATGCAATCTCGAGATTGCATGGTTTCTTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001001806.2-3208s1c1
Sequence:CCGGGCTGAAATGTTGGTGGTACATCTCGAGATGTACCACCAACATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173172    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001001806.2-2003s1c1
Sequence:CCGGCCAAACACTTAGGTCTCAGATCTCGAGATCTGAGACCTAAGTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001806
VALIDATED
ZFP36L2 MISSION shRNA Lentiviral Transduction Particles
ZFP36 ring finger protein-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001806.1-319s1c1
Sequence:CCGGCAAACCTCAATCTGAACAACACTCGAGTGTTGTTCAGATTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001001806.2-2497s1c1
Sequence:CCGGGCACCACAACTCAATATGAAACTCGAGTTTCATATTGAGTTGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001001806.2-2812s1c1
Sequence:CCGGCGCATGAAGAAACCATGCAATCTCGAGATTGCATGGTTTCTTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001001806.2-3208s1c1
Sequence:CCGGGCTGAAATGTTGGTGGTACATCTCGAGATGTACCACCAACATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173172    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001001806.2-2003s1c1
Sequence:CCGGCCAAACACTTAGGTCTCAGATCTCGAGATCTGAGACCTAAGTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks