EMAIL THIS PAGE TO A FRIEND

ZFP37

ZFP37 zinc finger protein

Synonyms: ZNF906 zfp-37
UniProtKB ID: Q9Y6Q3, A0AVJ9, B4DVX4, Q5T7Q4
Gene ID:
Mouse(22696) zinc finger protein 37
Rat(115768) zinc finger protein 37
domestic guinea pig(100721399) ZFP37 zinc finger protein
naked mole-rat(101711169) ZFP37 zinc finger protein
Domestic Rabbit(100345294) zinc finger protein 37 homolog (mouse)
cow(524796) ZFP37 zinc finger protein
sheep(101109509) zinc finger protein 37 homolog (mouse)
Horse(100056421) zinc finger protein 37 homolog (mouse)
dog(474806) zinc finger protein 37 homolog (mouse)
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003408 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003408 Rosetta Predictions human pricing
NM_058209 Rosetta Predictions rat pricing
NM_009554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240022 predicted 800
2 SASI_Hs01_00240024 predicted 922
3 SASI_Hs01_00240025 predicted 1914
4 SASI_Hs01_00240026 predicted 2012
5 SASI_Hs01_00240027 predicted 259
6 SASI_Hs02_00335610 predicted 1912
7 SASI_Hs01_00240028 predicted 1930
8 SASI_Hs01_00240029 predicted 787
9 SASI_Hs01_00240031 predicted 785
10 SASI_Hs02_00335611 predicted 1537
11 SASI_Hs01_00240023 predicted 1930
12 SASI_Hs01_00240030 predicted 1932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267177 predicted 586
2 SASI_Rn02_00267178 predicted 1404
3 SASI_Rn01_00116417 predicted 496
4 SASI_Rn02_00267179 predicted 518
5 SASI_Rn01_00116420 predicted 671
6 SASI_Rn02_00267180 predicted 284
7 SASI_Rn01_00116421 predicted 1319
8 SASI_Rn01_00116422 predicted 728
9 SASI_Rn01_00116423 predicted 1153
10 SASI_Rn02_00267181 predicted 203
11 SASI_Rn01_00116414 predicted 1207
12 SASI_Rn01_00116415 predicted 1487
13 SASI_Rn01_00116416 predicted 1765
14 SASI_Rn01_00116418 predicted 1789
15 SASI_Rn01_00116419 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061468 predicted 1985
2 SASI_Mm01_00061469 predicted 742
3 SASI_Mm01_00061470 predicted 1475
4 SASI_Mm01_00061471 predicted 633
5 SASI_Mm01_00061472 predicted 430
6 SASI_Mm01_00061473 predicted 1898
7 SASI_Mm01_00061474 predicted 2041
8 SASI_Mm01_00061475 predicted 1397
9 SASI_Mm02_00316400 predicted 803
10 SASI_Mm02_00316401 predicted 281
11 SASI_Mm01_00061466 predicted 423
12 SASI_Mm01_00061467 predicted 1526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009554
ZFP37 MISSION shRNA Bacterial Glycerol Stock
ZFP37 zinc finger protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-630s1c1
Sequence:CCGGGCGACAAGTTACCCAACAATACTCGAGTATTGTTGGGTAACTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-1035s1c1
Sequence:CCGGCTGACCATCTAAGAATCCATACTCGAGTATGGATTCTTAGATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-1282s1c1
Sequence:CCGGCCTGACTAAACATATGCGGATCTCGAGATCCGCATATGTTTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-1443s1c1
Sequence:CCGGGCTCATCTCTTACCTACCATACTCGAGTATGGTAGGTAAGAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-641s1c1
Sequence:CCGGCCCAACAATAAGTTGTCTGATCTCGAGATCAGACAACTTATTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009554
ZFP37 MISSION shRNA shRNA Plasmid DNA
ZFP37 zinc finger protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-630s1c1
Sequence:CCGGGCGACAAGTTACCCAACAATACTCGAGTATTGTTGGGTAACTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-1035s1c1
Sequence:CCGGCTGACCATCTAAGAATCCATACTCGAGTATGGATTCTTAGATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-1282s1c1
Sequence:CCGGCCTGACTAAACATATGCGGATCTCGAGATCCGCATATGTTTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-1443s1c1
Sequence:CCGGGCTCATCTCTTACCTACCATACTCGAGTATGGTAGGTAAGAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-641s1c1
Sequence:CCGGCCCAACAATAAGTTGTCTGATCTCGAGATCAGACAACTTATTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009554
ZFP37 MISSION shRNA Lentiviral Transduction Particles
ZFP37 zinc finger protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-630s1c1
Sequence:CCGGGCGACAAGTTACCCAACAATACTCGAGTATTGTTGGGTAACTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-1035s1c1
Sequence:CCGGCTGACCATCTAAGAATCCATACTCGAGTATGGATTCTTAGATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-1282s1c1
Sequence:CCGGCCTGACTAAACATATGCGGATCTCGAGATCCGCATATGTTTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-1443s1c1
Sequence:CCGGGCTCATCTCTTACCTACCATACTCGAGTATGGTAGGTAAGAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009554.1-641s1c1
Sequence:CCGGCCCAACAATAAGTTGTCTGATCTCGAGATCAGACAACTTATTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003408
ZFP37 MISSION shRNA Bacterial Glycerol Stock
ZFP37 zinc finger protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003408.1-2333s1c1
Sequence:CCGGGCCATCTGTATAAGCCTCTTTCTCGAGAAAGAGGCTTATACAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003408.1-1530s1c1
Sequence:CCGGGCTCATCTCTTACTTACCATACTCGAGTATGGTAAGTAAGAGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003408.1-182s1c1
Sequence:CCGGGCTCAGAGCAACCTGTATAATCTCGAGATTATACAGGTTGCTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003408.1-786s1c1
Sequence:CCGGGCTGTCATAGTTCATCCCATACTCGAGTATGGGATGAACTATGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003408.1-861s1c1
Sequence:CCGGGCTCATCTACTAAGCATGAAACTCGAGTTTCATGCTTAGTAGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003408.1-2212s21c1
Sequence:CCGGGCAATGGAGAAACAAGTTATACTCGAGTATAACTTGTTTCTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003408.1-2072s21c1
Sequence:CCGGTGGATGGAAACAAGGGTTTAACTCGAGTTAAACCCTTGTTTCCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003408.1-924s21c1
Sequence:CCGGGAAAGGTTCTCAGCCATAAACCTCGAGGTTTATGGCTGAGAACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003408.1-658s21c1
Sequence:CCGGGTCATTCAACCATAGCTTATCCTCGAGGATAAGCTATGGTTGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003408
ZFP37 MISSION shRNA shRNA Plasmid DNA
ZFP37 zinc finger protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003408.1-2333s1c1
Sequence:CCGGGCCATCTGTATAAGCCTCTTTCTCGAGAAAGAGGCTTATACAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003408.1-1530s1c1
Sequence:CCGGGCTCATCTCTTACTTACCATACTCGAGTATGGTAAGTAAGAGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003408.1-182s1c1
Sequence:CCGGGCTCAGAGCAACCTGTATAATCTCGAGATTATACAGGTTGCTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003408.1-786s1c1
Sequence:CCGGGCTGTCATAGTTCATCCCATACTCGAGTATGGGATGAACTATGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003408.1-861s1c1
Sequence:CCGGGCTCATCTACTAAGCATGAAACTCGAGTTTCATGCTTAGTAGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003408.1-2212s21c1
Sequence:CCGGGCAATGGAGAAACAAGTTATACTCGAGTATAACTTGTTTCTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003408.1-2072s21c1
Sequence:CCGGTGGATGGAAACAAGGGTTTAACTCGAGTTAAACCCTTGTTTCCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003408.1-924s21c1
Sequence:CCGGGAAAGGTTCTCAGCCATAAACCTCGAGGTTTATGGCTGAGAACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003408.1-658s21c1
Sequence:CCGGGTCATTCAACCATAGCTTATCCTCGAGGATAAGCTATGGTTGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003408
ZFP37 MISSION shRNA Lentiviral Transduction Particles
ZFP37 zinc finger protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003408.1-2333s1c1
Sequence:CCGGGCCATCTGTATAAGCCTCTTTCTCGAGAAAGAGGCTTATACAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003408.1-1530s1c1
Sequence:CCGGGCTCATCTCTTACTTACCATACTCGAGTATGGTAAGTAAGAGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003408.1-182s1c1
Sequence:CCGGGCTCAGAGCAACCTGTATAATCTCGAGATTATACAGGTTGCTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003408.1-786s1c1
Sequence:CCGGGCTGTCATAGTTCATCCCATACTCGAGTATGGGATGAACTATGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003408.1-861s1c1
Sequence:CCGGGCTCATCTACTAAGCATGAAACTCGAGTTTCATGCTTAGTAGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003408.1-2212s21c1
Sequence:CCGGGCAATGGAGAAACAAGTTATACTCGAGTATAACTTGTTTCTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003408.1-2072s21c1
Sequence:CCGGTGGATGGAAACAAGGGTTTAACTCGAGTTAAACCCTTGTTTCCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003408.1-924s21c1
Sequence:CCGGGAAAGGTTCTCAGCCATAAACCTCGAGGTTTATGGCTGAGAACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003408.1-658s21c1
Sequence:CCGGGTCATTCAACCATAGCTTATCCTCGAGGATAAGCTATGGTTGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks