EMAIL THIS PAGE TO A FRIEND

ZFP3

ZFP3 zinc finger protein

Synonyms: ZNF752
UniProtKB ID: Q96NJ6, A5PLL4
Gene ID:
Mouse(193043) zinc finger protein 3
Rat(497944) zinc finger protein 3
cow(538648) zinc finger protein 3 homolog (mouse)
sheep(101107293) zinc finger protein 3 homolog (mouse)
domestic guinea pig(101788251) ZFP3 zinc finger protein
naked mole-rat(101724946) ZFP3 zinc finger protein
Thale Cress(832587) zinc finger protein 3
Horse(100061153) zinc finger protein 3 homolog (mouse)
domestic cat(101090811) zinc finger protein 3 homolog (mouse)
dog(489452) zinc finger protein 3 homolog (mouse)
chicken(427922) zinc finger protein 3 homolog (mouse)
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153018 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU084231 MISSION® esiRNA esiRNA targeting mouse Zfp3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153018 Rosetta Predictions human pricing
NM_001109034 Rosetta Predictions rat pricing
NM_177565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162296 predicted 733
2 SASI_Hs01_00162297 predicted 903
3 SASI_Hs01_00162298 predicted 449
4 SASI_Hs01_00162299 predicted 1084
5 SASI_Hs01_00162300 predicted 434
6 SASI_Hs01_00162301 predicted 229
7 SASI_Hs01_00162302 predicted 423
8 SASI_Hs01_00162303 predicted 369
9 SASI_Hs01_00162304 predicted 909
10 SASI_Hs01_00162305 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244524 predicted 1094
2 SASI_Rn02_00244525 predicted 1769
3 SASI_Rn02_00244526 predicted 1269
4 SASI_Rn02_00244527 predicted 2165
5 SASI_Rn02_00244528 predicted 1179
6 SASI_Rn02_00244529 predicted 1194
7 SASI_Rn02_00244530 predicted 1077
8 SASI_Rn02_00244531 predicted 1225
9 SASI_Rn02_00244532 predicted 910
10 SASI_Rn02_00244533 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058970 predicted 265
2 SASI_Mm01_00058971 predicted 1381
3 SASI_Mm01_00058972 predicted 612
4 SASI_Mm01_00058973 predicted 1436
5 SASI_Mm01_00058974 predicted 1537
6 SASI_Mm01_00058975 predicted 320
7 SASI_Mm01_00058976 predicted 1011
8 SASI_Mm01_00058977 predicted 557
9 SASI_Mm01_00058978 predicted 716
10 SASI_Mm01_00058979 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153018
ZFP3 MISSION shRNA Bacterial Glycerol Stock
ZFP3 zinc finger protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153018.2-2008s21c1
Sequence:CCGGAGCTCTTTCAGGCCTTAATTTCTCGAGAAATTAAGGCCTGAAAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153018.2-177s21c1
Sequence:CCGGTCTGAGCCACATGGGTCATTACTCGAGTAATGACCCATGTGGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153018.2-283s21c1
Sequence:CCGGAGTCCATGGAAGAGGTTATAGCTCGAGCTATAACCTCTTCCATGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-1165s1c1
Sequence:CCGGGCCAGAACTCAGAGATTATTACTCGAGTAATAATCTCTGAGTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-1309s1c1
Sequence:CCGGGCTTTGAGTGTGGAAAGGCTTCTCGAGAAGCCTTTCCACACTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-153s1c1
Sequence:CCGGCCCAAGGAAGAAATTTCTGAACTCGAGTTCAGAAATTTCTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-1606s1c1
Sequence:CCGGGACATCAAAGTGTTCACTGTACTCGAGTACAGTGAACACTTTGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-442s1c1
Sequence:CCGGGAGATACAACAGAGGGAGTTACTCGAGTAACTCCCTCTGTTGTATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153018
ZFP3 MISSION shRNA shRNA Plasmid DNA
ZFP3 zinc finger protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153018.2-2008s21c1
Sequence:CCGGAGCTCTTTCAGGCCTTAATTTCTCGAGAAATTAAGGCCTGAAAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153018.2-177s21c1
Sequence:CCGGTCTGAGCCACATGGGTCATTACTCGAGTAATGACCCATGTGGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153018.2-283s21c1
Sequence:CCGGAGTCCATGGAAGAGGTTATAGCTCGAGCTATAACCTCTTCCATGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-1165s1c1
Sequence:CCGGGCCAGAACTCAGAGATTATTACTCGAGTAATAATCTCTGAGTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-1309s1c1
Sequence:CCGGGCTTTGAGTGTGGAAAGGCTTCTCGAGAAGCCTTTCCACACTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-153s1c1
Sequence:CCGGCCCAAGGAAGAAATTTCTGAACTCGAGTTCAGAAATTTCTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-1606s1c1
Sequence:CCGGGACATCAAAGTGTTCACTGTACTCGAGTACAGTGAACACTTTGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-442s1c1
Sequence:CCGGGAGATACAACAGAGGGAGTTACTCGAGTAACTCCCTCTGTTGTATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153018
ZFP3 MISSION shRNA Lentiviral Transduction Particles
ZFP3 zinc finger protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153018.2-2008s21c1
Sequence:CCGGAGCTCTTTCAGGCCTTAATTTCTCGAGAAATTAAGGCCTGAAAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153018.2-177s21c1
Sequence:CCGGTCTGAGCCACATGGGTCATTACTCGAGTAATGACCCATGTGGCTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153018.2-283s21c1
Sequence:CCGGAGTCCATGGAAGAGGTTATAGCTCGAGCTATAACCTCTTCCATGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-1165s1c1
Sequence:CCGGGCCAGAACTCAGAGATTATTACTCGAGTAATAATCTCTGAGTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-1309s1c1
Sequence:CCGGGCTTTGAGTGTGGAAAGGCTTCTCGAGAAGCCTTTCCACACTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-153s1c1
Sequence:CCGGCCCAAGGAAGAAATTTCTGAACTCGAGTTCAGAAATTTCTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-1606s1c1
Sequence:CCGGGACATCAAAGTGTTCACTGTACTCGAGTACAGTGAACACTTTGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153018.1-442s1c1
Sequence:CCGGGAGATACAACAGAGGGAGTTACTCGAGTAACTCCCTCTGTTGTATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177565
ZFP3 MISSION shRNA Bacterial Glycerol Stock
ZFP3 zinc finger protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177565.2-1645s1c1
Sequence:CCGGAGACTTCTCCATTGCTCTGTACTCGAGTACAGAGCAATGGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177565.2-381s1c1
Sequence:CCGGGAGGCTTTAATCCTAACCCTACTCGAGTAGGGTTAGGATTAAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177565.2-269s1c1
Sequence:CCGGGAGTCCTCGAAAGAGATTATACTCGAGTATAATCTCTTTCGAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177565.2-310s1c1
Sequence:CCGGGAGACACTTTGCATCTGGGTTCTCGAGAACCCAGATGCAAAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177565.2-1387s1c1
Sequence:CCGGCTGGGATAATTCTGAGCTGTTCTCGAGAACAGCTCAGAATTATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177565
ZFP3 MISSION shRNA shRNA Plasmid DNA
ZFP3 zinc finger protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177565.2-1645s1c1
Sequence:CCGGAGACTTCTCCATTGCTCTGTACTCGAGTACAGAGCAATGGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177565.2-381s1c1
Sequence:CCGGGAGGCTTTAATCCTAACCCTACTCGAGTAGGGTTAGGATTAAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177565.2-269s1c1
Sequence:CCGGGAGTCCTCGAAAGAGATTATACTCGAGTATAATCTCTTTCGAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177565.2-310s1c1
Sequence:CCGGGAGACACTTTGCATCTGGGTTCTCGAGAACCCAGATGCAAAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177565.2-1387s1c1
Sequence:CCGGCTGGGATAATTCTGAGCTGTTCTCGAGAACAGCTCAGAATTATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177565
ZFP3 MISSION shRNA Lentiviral Transduction Particles
ZFP3 zinc finger protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177565.2-1645s1c1
Sequence:CCGGAGACTTCTCCATTGCTCTGTACTCGAGTACAGAGCAATGGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177565.2-381s1c1
Sequence:CCGGGAGGCTTTAATCCTAACCCTACTCGAGTAGGGTTAGGATTAAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177565.2-269s1c1
Sequence:CCGGGAGTCCTCGAAAGAGATTATACTCGAGTATAATCTCTTTCGAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177565.2-310s1c1
Sequence:CCGGGAGACACTTTGCATCTGGGTTCTCGAGAACCCAGATGCAAAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177565.2-1387s1c1
Sequence:CCGGCTGGGATAATTCTGAGCTGTTCTCGAGAACAGCTCAGAATTATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks