EMAIL THIS PAGE TO A FRIEND

ZFP41

ZFP41 zinc finger protein

Synonyms: ZNF753 zfp-41
UniProtKB ID: Q8N8Y5, D3DWJ5
Gene ID:
Mouse(22701) zinc finger protein 41
Rat(315081) zinc finger protein 41
domestic guinea pig(100732908) ZFP41 zinc finger protein
cow(790017) ZFP41 zinc finger protein
sheep(101118282) zinc finger protein 41 homolog (mouse)
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173832 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173832 Rosetta Predictions human pricing
XM_001074254 Rosetta Predictions rat pricing
XM_235429 Rosetta Predictions rat pricing
NM_001044718 Rosetta Predictions mouse pricing
NM_011759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048570 predicted 1389
2 SASI_Hs01_00048571 predicted 818
3 SASI_Hs02_00368705 predicted 1283
4 SASI_Hs01_00048573 predicted 1263
5 SASI_Hs01_00048574 predicted 1141
6 SASI_Hs01_00048576 predicted 1193
7 SASI_Hs01_00048577 predicted 1369
8 SASI_Hs01_00048578 predicted 506
9 SASI_Hs01_00048579 predicted 361
10 SASI_Hs02_00368706 predicted 1385
11 SASI_Hs01_00048572 predicted 814
12 SASI_Hs01_00048575 predicted 1366
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345581 predicted 345
2 SASI_Rn02_00345582 predicted 791
3 SASI_Rn02_00345583 predicted 770
4 SASI_Rn02_00345584 predicted 428
5 SASI_Rn02_00345585 predicted 742
6 SASI_Rn02_00345586 predicted 514
7 SASI_Rn02_00345587 predicted 324
8 SASI_Rn02_00345588 predicted 348
9 SASI_Rn02_00345589 predicted 742
10 SASI_Rn02_00345590 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389299 predicted 336
2 SASI_Rn02_00389300 predicted 786
3 SASI_Rn02_00389301 predicted 766
4 SASI_Rn02_00389302 predicted 432
5 SASI_Rn02_00389303 predicted 740
6 SASI_Rn02_00389304 predicted 511
7 SASI_Rn02_00389305 predicted 328
8 SASI_Rn02_00389306 predicted 355
9 SASI_Rn02_00389307 predicted 742
10 SASI_Rn02_00389308 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291364 predicted 741
2 SASI_Mm02_00291365 predicted 794
3 SASI_Mm02_00291366 predicted 1091
4 SASI_Mm02_00291367 predicted 558
5 SASI_Mm02_00291368 predicted 465
6 SASI_Mm02_00291369 predicted 488
7 SASI_Mm02_00291370 predicted 631
8 SASI_Mm02_00291371 predicted 1384
9 SASI_Mm02_00291372 predicted 1326
10 SASI_Mm02_00291373 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024992 predicted 948
2 SASI_Mm01_00024993 predicted 1006
3 SASI_Mm01_00024994 predicted 1307
4 SASI_Mm01_00024995 predicted 766
5 SASI_Mm01_00024996 predicted 670
6 SASI_Mm01_00024997 predicted 692
7 SASI_Mm01_00024999 predicted 838
8 SASI_Mm01_00025000 predicted 1591
9 SASI_Mm01_00025001 predicted 1525
10 SASI_Mm02_00321358 predicted 943
11 SASI_Mm01_00024998 predicted 1205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173832
ZFP41 MISSION shRNA Bacterial Glycerol Stock
ZFP41 zinc finger protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173832.3-1370s21c1
Sequence:CCGGTGTGATGTCCACTCTGCTTAACTCGAGTTAAGCAGAGTGGACATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173832.3-1276s21c1
Sequence:CCGGCCATCCATTGGACGTGTTTGGCTCGAGCCAAACACGTCCAATGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173832.3-524s21c1
Sequence:CCGGGACGAAGAGCACGTCTTTGATCTCGAGATCAAAGACGTGCTCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173832.3-1148s21c1
Sequence:CCGGGAGAGTCTCTCTGATCAAGACCTCGAGGTCTTGATCAGAGAGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173832.2-553s1c1
Sequence:CCGGCGCTTCATTTAAAGATGACTTCTCGAGAAGTCATCTTTAAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173832.2-808s1c1
Sequence:CCGGAGCCTTTAACTGCGGCTCCAACTCGAGTTGGAGCCGCAGTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173832.2-866s1c1
Sequence:CCGGCCCTACGAATGCACGCACTGTCTCGAGACAGTGCGTGCATTCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173832.2-634s1c1
Sequence:CCGGTGGGCGGATCTTTAAGCACAACTCGAGTTGTGCTTAAAGATCCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173832.2-1207s1c1
Sequence:CCGGCCACAGAGCATTTACCAAGTTCTCGAGAACTTGGTAAATGCTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173832
ZFP41 MISSION shRNA shRNA Plasmid DNA
ZFP41 zinc finger protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173832.3-1370s21c1
Sequence:CCGGTGTGATGTCCACTCTGCTTAACTCGAGTTAAGCAGAGTGGACATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173832.3-1276s21c1
Sequence:CCGGCCATCCATTGGACGTGTTTGGCTCGAGCCAAACACGTCCAATGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173832.3-524s21c1
Sequence:CCGGGACGAAGAGCACGTCTTTGATCTCGAGATCAAAGACGTGCTCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173832.3-1148s21c1
Sequence:CCGGGAGAGTCTCTCTGATCAAGACCTCGAGGTCTTGATCAGAGAGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173832.2-553s1c1
Sequence:CCGGCGCTTCATTTAAAGATGACTTCTCGAGAAGTCATCTTTAAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173832.2-808s1c1
Sequence:CCGGAGCCTTTAACTGCGGCTCCAACTCGAGTTGGAGCCGCAGTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173832.2-866s1c1
Sequence:CCGGCCCTACGAATGCACGCACTGTCTCGAGACAGTGCGTGCATTCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173832.2-634s1c1
Sequence:CCGGTGGGCGGATCTTTAAGCACAACTCGAGTTGTGCTTAAAGATCCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173832.2-1207s1c1
Sequence:CCGGCCACAGAGCATTTACCAAGTTCTCGAGAACTTGGTAAATGCTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173832
ZFP41 MISSION shRNA Lentiviral Transduction Particles
ZFP41 zinc finger protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173832.3-1370s21c1
Sequence:CCGGTGTGATGTCCACTCTGCTTAACTCGAGTTAAGCAGAGTGGACATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173832.3-1276s21c1
Sequence:CCGGCCATCCATTGGACGTGTTTGGCTCGAGCCAAACACGTCCAATGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173832.3-524s21c1
Sequence:CCGGGACGAAGAGCACGTCTTTGATCTCGAGATCAAAGACGTGCTCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173832.3-1148s21c1
Sequence:CCGGGAGAGTCTCTCTGATCAAGACCTCGAGGTCTTGATCAGAGAGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173832.2-553s1c1
Sequence:CCGGCGCTTCATTTAAAGATGACTTCTCGAGAAGTCATCTTTAAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173832.2-808s1c1
Sequence:CCGGAGCCTTTAACTGCGGCTCCAACTCGAGTTGGAGCCGCAGTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173832.2-866s1c1
Sequence:CCGGCCCTACGAATGCACGCACTGTCTCGAGACAGTGCGTGCATTCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173832.2-634s1c1
Sequence:CCGGTGGGCGGATCTTTAAGCACAACTCGAGTTGTGCTTAAAGATCCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173832.2-1207s1c1
Sequence:CCGGCCACAGAGCATTTACCAAGTTCTCGAGAACTTGGTAAATGCTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011759
ZFP41 MISSION shRNA Bacterial Glycerol Stock
ZFP41 zinc finger protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011759.2-605s21c1
Sequence:CCGGAGGCAACCAAGAAGCCAAGAACTCGAGTTCTTGGCTTCTTGGTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011759.2-1147s21c1
Sequence:CCGGCCAGAGGTCTTACGCAGTATGCTCGAGCATACTGCGTAAGACCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011759.2-887s21c1
Sequence:CCGGATGTCACCAAACATCAAAGAACTCGAGTTCTTTGATGTTTGGTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011759.2-1247s21c1
Sequence:CCGGGAGTCTTCACTTAGTAGTAACCTCGAGGTTACTACTAAGTGAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011759.2-1320s21c1
Sequence:CCGGTGTTACTCAGGGCCATCTTTGCTCGAGCAAAGATGGCCCTGAGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011759.1-2291s1c1
Sequence:CCGGCCTGGGAACAAATGAAATGTTCTCGAGAACATTTCATTTGTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011759.1-733s1c1
Sequence:CCGGGTGAATGTGGACGGATCTTTACTCGAGTAAAGATCCGTCCACATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011759.1-651s1c1
Sequence:CCGGGCCTTCGATGCCTCGTTTAAACTCGAGTTTAAACGAGGCATCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011759.1-626s1c1
Sequence:CCGGCGAGGACGAAGCACATATCTTCTCGAGAAGATATGTGCTTCGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011759.1-923s1c1
Sequence:CCGGCTGTGGTTCTAACCTTCTAAACTCGAGTTTAGAAGGTTAGAACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011759
ZFP41 MISSION shRNA shRNA Plasmid DNA
ZFP41 zinc finger protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011759.2-605s21c1
Sequence:CCGGAGGCAACCAAGAAGCCAAGAACTCGAGTTCTTGGCTTCTTGGTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011759.2-1147s21c1
Sequence:CCGGCCAGAGGTCTTACGCAGTATGCTCGAGCATACTGCGTAAGACCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011759.2-887s21c1
Sequence:CCGGATGTCACCAAACATCAAAGAACTCGAGTTCTTTGATGTTTGGTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011759.2-1247s21c1
Sequence:CCGGGAGTCTTCACTTAGTAGTAACCTCGAGGTTACTACTAAGTGAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011759.2-1320s21c1
Sequence:CCGGTGTTACTCAGGGCCATCTTTGCTCGAGCAAAGATGGCCCTGAGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011759.1-2291s1c1
Sequence:CCGGCCTGGGAACAAATGAAATGTTCTCGAGAACATTTCATTTGTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011759.1-733s1c1
Sequence:CCGGGTGAATGTGGACGGATCTTTACTCGAGTAAAGATCCGTCCACATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011759.1-651s1c1
Sequence:CCGGGCCTTCGATGCCTCGTTTAAACTCGAGTTTAAACGAGGCATCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011759.1-626s1c1
Sequence:CCGGCGAGGACGAAGCACATATCTTCTCGAGAAGATATGTGCTTCGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011759.1-923s1c1
Sequence:CCGGCTGTGGTTCTAACCTTCTAAACTCGAGTTTAGAAGGTTAGAACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011759
ZFP41 MISSION shRNA Lentiviral Transduction Particles
ZFP41 zinc finger protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011759.2-605s21c1
Sequence:CCGGAGGCAACCAAGAAGCCAAGAACTCGAGTTCTTGGCTTCTTGGTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011759.2-1147s21c1
Sequence:CCGGCCAGAGGTCTTACGCAGTATGCTCGAGCATACTGCGTAAGACCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011759.2-887s21c1
Sequence:CCGGATGTCACCAAACATCAAAGAACTCGAGTTCTTTGATGTTTGGTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011759.2-1247s21c1
Sequence:CCGGGAGTCTTCACTTAGTAGTAACCTCGAGGTTACTACTAAGTGAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011759.2-1320s21c1
Sequence:CCGGTGTTACTCAGGGCCATCTTTGCTCGAGCAAAGATGGCCCTGAGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011759.1-2291s1c1
Sequence:CCGGCCTGGGAACAAATGAAATGTTCTCGAGAACATTTCATTTGTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011759.1-733s1c1
Sequence:CCGGGTGAATGTGGACGGATCTTTACTCGAGTAAAGATCCGTCCACATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011759.1-651s1c1
Sequence:CCGGGCCTTCGATGCCTCGTTTAAACTCGAGTTTAAACGAGGCATCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011759.1-626s1c1
Sequence:CCGGCGAGGACGAAGCACATATCTTCTCGAGAAGATATGTGCTTCGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011759.1-923s1c1
Sequence:CCGGCTGTGGTTCTAACCTTCTAAACTCGAGTTTAGAAGGTTAGAACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks