EMAIL THIS PAGE TO A FRIEND

ZFP42

ZFP42 zinc finger protein

Synonyms: REX1 ZNF754
UniProtKB ID: Q96MM3, D3DP65, Q8WXE2
Gene ID:
Mouse(22702) zinc finger protein 42
Rat(100361947) zinc finger protein 42
cow(100138651) ZFP42 zinc finger protein
sheep(101110027) zinc finger protein 42 homolog (mouse)
domestic guinea pig(100714391) ZFP42 zinc finger protein
naked mole-rat(101715725) ZFP42 zinc finger protein
dog(100682598) zinc finger protein 42 homolog (mouse)
domestic cat(101099040) zinc finger protein 42 homolog (mouse)
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1665 Human Rex-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174900 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174900 Rosetta Predictions human pricing
NM_009556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216603 predicted 1287
2 SASI_Hs02_00368788 predicted 1168
3 SASI_Hs01_00216604 predicted 998
4 SASI_Hs01_00216606 predicted 836
5 SASI_Hs01_00216608 predicted 1267
6 SASI_Hs01_00216609 predicted 597
7 SASI_Hs02_00368789 predicted 1256
8 SASI_Hs01_00216610 predicted 1017
9 SASI_Hs01_00216612 predicted 1014
10 SASI_Hs02_00368790 predicted 752
11 SASI_Hs01_00216605 predicted 1263
12 SASI_Hs01_00216607 predicted 905
13 SASI_Hs01_00216611 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112374 predicted 1202
2 SASI_Mm01_00112375 predicted 1204
3 SASI_Mm01_00112376 predicted 882
4 SASI_Mm02_00316405 predicted 926
5 SASI_Mm01_00112377 predicted 1359
6 SASI_Mm01_00112378 predicted 1357
7 SASI_Mm01_00112379 predicted 1344
8 SASI_Mm01_00112380 predicted 1078
9 SASI_Mm01_00112381 predicted 554
10 SASI_Mm01_00112382 predicted 895
11 SASI_Mm01_00112383 predicted 1279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174900
ZFP42 MISSION shRNA Bacterial Glycerol Stock
ZFP42 zinc finger protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174900.3-1381s21c1
Sequence:CCGGAGTGACAAACATGCCTCATTGCTCGAGCAATGAGGCATGTTTGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174900.3-748s21c1
Sequence:CCGGAGCTCCCTTGAATGTTCTTTGCTCGAGCAAAGAACATTCAAGGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174900.3-1653s21c1
Sequence:CCGGTGTTGGATTATTGGATATAAGCTCGAGCTTATATCCAATAATCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174900.3-620s21c1
Sequence:CCGGGTTACATAGAATGCGTCATAACTCGAGTTATGACGCATTCTATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174900.3-1471s21c1
Sequence:CCGGCTAAGATGCTCCTACACTTTGCTCGAGCAAAGTGTAGGAGCATCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174900.2-1359s1c1
Sequence:CCGGGCAGATTAACAGAAGAGTGATCTCGAGATCACTCTTCTGTTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174900.2-1302s1c1
Sequence:CCGGGCATGCAAATACGAACAAGAACTCGAGTTCTTGTTCGTATTTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174900.2-880s1c1
Sequence:CCGGCCTGGCATTGACCTATCAGATCTCGAGATCTGATAGGTCAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174900.2-912s1c1
Sequence:CCGGCGCAGAATTTGCTAGAAAGAACTCGAGTTCTTTCTAGCAAATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174900
ZFP42 MISSION shRNA shRNA Plasmid DNA
ZFP42 zinc finger protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174900.3-1381s21c1
Sequence:CCGGAGTGACAAACATGCCTCATTGCTCGAGCAATGAGGCATGTTTGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174900.3-748s21c1
Sequence:CCGGAGCTCCCTTGAATGTTCTTTGCTCGAGCAAAGAACATTCAAGGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174900.3-1653s21c1
Sequence:CCGGTGTTGGATTATTGGATATAAGCTCGAGCTTATATCCAATAATCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174900.3-620s21c1
Sequence:CCGGGTTACATAGAATGCGTCATAACTCGAGTTATGACGCATTCTATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174900.3-1471s21c1
Sequence:CCGGCTAAGATGCTCCTACACTTTGCTCGAGCAAAGTGTAGGAGCATCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174900.2-1359s1c1
Sequence:CCGGGCAGATTAACAGAAGAGTGATCTCGAGATCACTCTTCTGTTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174900.2-1302s1c1
Sequence:CCGGGCATGCAAATACGAACAAGAACTCGAGTTCTTGTTCGTATTTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174900.2-880s1c1
Sequence:CCGGCCTGGCATTGACCTATCAGATCTCGAGATCTGATAGGTCAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174900.2-912s1c1
Sequence:CCGGCGCAGAATTTGCTAGAAAGAACTCGAGTTCTTTCTAGCAAATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174900
ZFP42 MISSION shRNA Lentiviral Transduction Particles
ZFP42 zinc finger protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174900.3-1381s21c1
Sequence:CCGGAGTGACAAACATGCCTCATTGCTCGAGCAATGAGGCATGTTTGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174900.3-748s21c1
Sequence:CCGGAGCTCCCTTGAATGTTCTTTGCTCGAGCAAAGAACATTCAAGGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174900.3-1653s21c1
Sequence:CCGGTGTTGGATTATTGGATATAAGCTCGAGCTTATATCCAATAATCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174900.3-620s21c1
Sequence:CCGGGTTACATAGAATGCGTCATAACTCGAGTTATGACGCATTCTATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174900.3-1471s21c1
Sequence:CCGGCTAAGATGCTCCTACACTTTGCTCGAGCAAAGTGTAGGAGCATCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174900.2-1359s1c1
Sequence:CCGGGCAGATTAACAGAAGAGTGATCTCGAGATCACTCTTCTGTTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174900.2-1302s1c1
Sequence:CCGGGCATGCAAATACGAACAAGAACTCGAGTTCTTGTTCGTATTTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174900.2-880s1c1
Sequence:CCGGCCTGGCATTGACCTATCAGATCTCGAGATCTGATAGGTCAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174900.2-912s1c1
Sequence:CCGGCGCAGAATTTGCTAGAAAGAACTCGAGTTCTTTCTAGCAAATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009556
ZFP42 MISSION shRNA Bacterial Glycerol Stock
ZFP42 zinc finger protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009556.3-1360s21c1
Sequence:CCGGGGGATAGATTCTATGGCTAAACTCGAGTTTAGCCATAGAATCTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009556.3-484s21c1
Sequence:CCGGCTCGACAGACTGACCCTAAAGCTCGAGCTTTAGGGTCAGTCTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009556.3-1129s21c1
Sequence:CCGGTTCAACTTGCGCACCCATATCCTCGAGGATATGGGTGCGCAAGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009556.3-1192s21c1
Sequence:CCGGGGCTGCGAGAAGAGCTTTATTCTCGAGAATAAAGCTCTTCTCGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009556.3-566s21c1
Sequence:CCGGTCCGGGATGAAAGTGAGATTACTCGAGTAATCTCACTTTCATCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009556.2-1582s1c1
Sequence:CCGGGCAGTAGTCAACAAATGAATACTCGAGTATTCATTTGTTGACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009556.2-993s1c1
Sequence:CCGGGCTCGAAACTAAAGCGACATTCTCGAGAATGTCGCTTTAGTTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009556.2-843s1c1
Sequence:CCGGGTGTGTACTGTGGTGTCTTATCTCGAGATAAGACACCACAGTACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009556.2-992s1c1
Sequence:CCGGAGCTCGAAACTAAAGCGACATCTCGAGATGTCGCTTTAGTTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009556.2-574s1c1
Sequence:CCGGCGGATACCTAGAGTGCATCATCTCGAGATGATGCACTCTAGGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009556
ZFP42 MISSION shRNA shRNA Plasmid DNA
ZFP42 zinc finger protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009556.3-1360s21c1
Sequence:CCGGGGGATAGATTCTATGGCTAAACTCGAGTTTAGCCATAGAATCTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009556.3-484s21c1
Sequence:CCGGCTCGACAGACTGACCCTAAAGCTCGAGCTTTAGGGTCAGTCTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009556.3-1129s21c1
Sequence:CCGGTTCAACTTGCGCACCCATATCCTCGAGGATATGGGTGCGCAAGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009556.3-1192s21c1
Sequence:CCGGGGCTGCGAGAAGAGCTTTATTCTCGAGAATAAAGCTCTTCTCGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009556.3-566s21c1
Sequence:CCGGTCCGGGATGAAAGTGAGATTACTCGAGTAATCTCACTTTCATCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009556.2-1582s1c1
Sequence:CCGGGCAGTAGTCAACAAATGAATACTCGAGTATTCATTTGTTGACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009556.2-993s1c1
Sequence:CCGGGCTCGAAACTAAAGCGACATTCTCGAGAATGTCGCTTTAGTTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009556.2-843s1c1
Sequence:CCGGGTGTGTACTGTGGTGTCTTATCTCGAGATAAGACACCACAGTACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009556.2-992s1c1
Sequence:CCGGAGCTCGAAACTAAAGCGACATCTCGAGATGTCGCTTTAGTTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009556.2-574s1c1
Sequence:CCGGCGGATACCTAGAGTGCATCATCTCGAGATGATGCACTCTAGGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009556
ZFP42 MISSION shRNA Lentiviral Transduction Particles
ZFP42 zinc finger protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009556.3-1360s21c1
Sequence:CCGGGGGATAGATTCTATGGCTAAACTCGAGTTTAGCCATAGAATCTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009556.3-484s21c1
Sequence:CCGGCTCGACAGACTGACCCTAAAGCTCGAGCTTTAGGGTCAGTCTGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009556.3-1129s21c1
Sequence:CCGGTTCAACTTGCGCACCCATATCCTCGAGGATATGGGTGCGCAAGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009556.3-1192s21c1
Sequence:CCGGGGCTGCGAGAAGAGCTTTATTCTCGAGAATAAAGCTCTTCTCGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009556.3-566s21c1
Sequence:CCGGTCCGGGATGAAAGTGAGATTACTCGAGTAATCTCACTTTCATCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009556.2-1582s1c1
Sequence:CCGGGCAGTAGTCAACAAATGAATACTCGAGTATTCATTTGTTGACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009556.2-993s1c1
Sequence:CCGGGCTCGAAACTAAAGCGACATTCTCGAGAATGTCGCTTTAGTTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009556.2-843s1c1
Sequence:CCGGGTGTGTACTGTGGTGTCTTATCTCGAGATAAGACACCACAGTACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009556.2-992s1c1
Sequence:CCGGAGCTCGAAACTAAAGCGACATCTCGAGATGTCGCTTTAGTTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009556.2-574s1c1
Sequence:CCGGCGGATACCTAGAGTGCATCATCTCGAGATGATGCACTCTAGGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks