EMAIL THIS PAGE TO A FRIEND

ZFP57

ZFP57 zinc finger protein

Synonyms: C6orf40 TNDM1 ZNF698 bA145L22 bA145L22.2
UniProtKB ID: Q9NU63, B0S894, B0V254, B2RXJ7, Q5SSB1
Gene ID:
Human(346171) Summary: The protein encoded by this gene is a zinc finger protein containing a KRAB domain. Studies in mouse suggest that this protein may function as a transcriptional repressor. Mutations in this gene have been associated with transient neonatal diabetes mellitus type 1 (TNDM1).[provided by RefSeq, Sep 2009]
Mouse(22715) zinc finger protein 57
Rat(361783) zinc finger protein 57
domestic guinea pig(100714711) ZFP57 zinc finger protein
naked mole-rat(101719128) ZFP57 zinc finger protein
cow(786262) ZFP57 zinc finger protein
sheep(101109748) zinc finger protein 57 homolog (mouse)
dog(488342) zinc finger protein 57 homolog (mouse)
Horse(100056823) zinc finger protein 57 homolog (mouse)
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009559 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009559 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009559 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001109809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001109809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001109809 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU227581 MISSION® esiRNA esiRNA targeting human ZFP57 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109809 Rosetta Predictions human pricing
XM_294093 Rosetta Predictions human pricing
NM_213565 Rosetta Predictions rat pricing
NM_001013745 Rosetta Predictions mouse pricing
NM_009559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324753 predicted 548
2 SASI_Hs02_00324754 predicted 918
3 SASI_Hs02_00324755 predicted 556
4 SASI_Hs02_00324756 predicted 1698
5 SASI_Hs02_00324757 predicted 1062
6 SASI_Hs02_00324758 predicted 1729
7 SASI_Hs02_00324759 predicted 1207
8 SASI_Hs02_00324760 predicted 757
9 SASI_Hs02_00324761 predicted 568
10 SASI_Hs02_00324762 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_294093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289449 predicted 548
2 SASI_Hs01_00289450 predicted 1536
3 SASI_Hs01_00289451 predicted 914
4 SASI_Hs01_00289452 predicted 556
5 SASI_Hs01_00289453 predicted 1696
6 SASI_Hs01_00289454 predicted 1059
7 SASI_Hs01_00289455 predicted 1727
8 SASI_Hs01_00289456 predicted 1205
9 SASI_Hs01_00289457 predicted 1465
10 SASI_Hs01_00289458 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270602 predicted 517
2 SASI_Rn02_00270603 predicted 389
3 SASI_Rn02_00270604 predicted 1212
4 SASI_Rn02_00270605 predicted 223
5 SASI_Rn01_00107032 predicted 862
6 SASI_Rn01_00107034 predicted 294
7 SASI_Rn02_00270606 predicted 892
8 SASI_Rn02_00270607 predicted 841
9 SASI_Rn02_00270608 predicted 1339
10 SASI_Rn01_00107035 predicted 263
11 SASI_Rn01_00107031 predicted 466
12 SASI_Rn01_00107033 predicted 411
13 SASI_Rn01_00107036 predicted 1154
14 SASI_Rn01_00107037 predicted 370
15 SASI_Rn01_00107038 predicted 782
16 SASI_Rn01_00107039 predicted 1394
17 SASI_Rn01_00107040 predicted 1363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287279 predicted 661
2 SASI_Mm01_00071583 predicted 1094
3 SASI_Mm01_00071584 predicted 871
4 SASI_Mm01_00071585 predicted 488
5 SASI_Mm01_00071586 predicted 786
6 SASI_Mm01_00071587 predicted 1153
7 SASI_Mm01_00071588 predicted 575
8 SASI_Mm02_00287280 predicted 498
9 SASI_Mm01_00071590 predicted 1093
10 SASI_Mm02_00287281 predicted 873
11 SASI_Mm01_00071589 predicted 1167
12 SASI_Mm01_00071591 predicted 961
13 SASI_Mm01_00071592 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316410 predicted 846
2 SASI_Mm01_00174120 predicted 1278
3 SASI_Mm01_00174121 predicted 1058
4 SASI_Mm01_00174122 predicted 669
5 SASI_Mm01_00174123 predicted 978
6 SASI_Mm01_00174124 predicted 1332
7 SASI_Mm01_00174125 predicted 752
8 SASI_Mm02_00316411 predicted 689
9 SASI_Mm01_00174127 predicted 1281
10 SASI_Mm02_00316412 predicted 1057
11 SASI_Mm01_00174126 predicted 1342
12 SASI_Mm01_00174128 predicted 1148
13 SASI_Mm01_00174129 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009559
VALIDATED
ZFP57 MISSION shRNA Bacterial Glycerol Stock
ZFP57 zinc finger protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-1569s21c1
Sequence:CCGGTGGGAAATCCTGGGTCATTTGCTCGAGCAAATGACCCAGGATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-1339s21c1
Sequence:CCGGCCTATTGTCACATAACGTTTACTCGAGTAAACGTTATGTGACAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-728s21c1
Sequence:CCGGTAGCTCAGATCTGCAAGATAACTCGAGTTATCTTGCAGATCTGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-1285s21c1
Sequence:CCGGATGTCAGATCCAACTCTATTACTCGAGTAATAGAGTTGGATCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-1607s21c1
Sequence:CCGGACCCGTGGTGCTGGGAAATATCTCGAGATATTTCCCAGCACCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-689s1c1
Sequence:CCGGCCTGACATTTGTCGGAAGCAACTCGAGTTGCTTCCGACAAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-1450s1c1
Sequence:CCGGCCAACACACTCAGAATGCAAACTCGAGTTTGCATTCTGAGTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-1013s1c1
Sequence:CCGGCCGACGTGCTCATTTAGGTTACTCGAGTAACCTAAATGAGCACGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-1537s1c1
Sequence:CCGGGCTGCCAAAGACCAATCAGATCTCGAGATCTGATTGGTCTTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-1014s1c1
Sequence:CCGGCGACGTGCTCATTTAGGTTATCTCGAGATAACCTAAATGAGCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009559
VALIDATED
ZFP57 MISSION shRNA shRNA Plasmid DNA
ZFP57 zinc finger protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-1569s21c1
Sequence:CCGGTGGGAAATCCTGGGTCATTTGCTCGAGCAAATGACCCAGGATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-1339s21c1
Sequence:CCGGCCTATTGTCACATAACGTTTACTCGAGTAAACGTTATGTGACAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-728s21c1
Sequence:CCGGTAGCTCAGATCTGCAAGATAACTCGAGTTATCTTGCAGATCTGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-1285s21c1
Sequence:CCGGATGTCAGATCCAACTCTATTACTCGAGTAATAGAGTTGGATCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-1607s21c1
Sequence:CCGGACCCGTGGTGCTGGGAAATATCTCGAGATATTTCCCAGCACCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-689s1c1
Sequence:CCGGCCTGACATTTGTCGGAAGCAACTCGAGTTGCTTCCGACAAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-1450s1c1
Sequence:CCGGCCAACACACTCAGAATGCAAACTCGAGTTTGCATTCTGAGTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-1013s1c1
Sequence:CCGGCCGACGTGCTCATTTAGGTTACTCGAGTAACCTAAATGAGCACGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-1537s1c1
Sequence:CCGGGCTGCCAAAGACCAATCAGATCTCGAGATCTGATTGGTCTTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-1014s1c1
Sequence:CCGGCGACGTGCTCATTTAGGTTATCTCGAGATAACCTAAATGAGCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009559
VALIDATED
ZFP57 MISSION shRNA Lentiviral Transduction Particles
ZFP57 zinc finger protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-1569s21c1
Sequence:CCGGTGGGAAATCCTGGGTCATTTGCTCGAGCAAATGACCCAGGATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-1339s21c1
Sequence:CCGGCCTATTGTCACATAACGTTTACTCGAGTAAACGTTATGTGACAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-728s21c1
Sequence:CCGGTAGCTCAGATCTGCAAGATAACTCGAGTTATCTTGCAGATCTGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-1285s21c1
Sequence:CCGGATGTCAGATCCAACTCTATTACTCGAGTAATAGAGTTGGATCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009559.2-1607s21c1
Sequence:CCGGACCCGTGGTGCTGGGAAATATCTCGAGATATTTCCCAGCACCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-689s1c1
Sequence:CCGGCCTGACATTTGTCGGAAGCAACTCGAGTTGCTTCCGACAAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-1450s1c1
Sequence:CCGGCCAACACACTCAGAATGCAAACTCGAGTTTGCATTCTGAGTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-1013s1c1
Sequence:CCGGCCGACGTGCTCATTTAGGTTACTCGAGTAACCTAAATGAGCACGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-1537s1c1
Sequence:CCGGGCTGCCAAAGACCAATCAGATCTCGAGATCTGATTGGTCTTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009559.2-1014s1c1
Sequence:CCGGCGACGTGCTCATTTAGGTTATCTCGAGATAACCTAAATGAGCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001109809
ZFP57 MISSION shRNA Bacterial Glycerol Stock
ZFP57 zinc finger protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-565s21c1
Sequence:CCGGTGTTATGTCGGAAACCTTTAACTCGAGTTAAAGGTTTCCGACATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-1378s21c1
Sequence:CCGGGAACCAGGCATCTGTACTTAACTCGAGTTAAGTACAGATGCCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-1604s21c1
Sequence:GTACCGGAGCAAGTCTTTCAGCTCATTTCTCGAGAAATGAGCTGAAAGACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-1755s21c1
Sequence:CCGGGCCAGAGCAGCCACCATAAATCTCGAGATTTATGGTGGCTGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-1334s21c1
Sequence:CCGGAGGTCCCAGGAACCCATATTTCTCGAGAAATATGGGTTCCTGGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001109809
ZFP57 MISSION shRNA shRNA Plasmid DNA
ZFP57 zinc finger protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-565s21c1
Sequence:CCGGTGTTATGTCGGAAACCTTTAACTCGAGTTAAAGGTTTCCGACATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-1378s21c1
Sequence:CCGGGAACCAGGCATCTGTACTTAACTCGAGTTAAGTACAGATGCCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-1604s21c1
Sequence:GTACCGGAGCAAGTCTTTCAGCTCATTTCTCGAGAAATGAGCTGAAAGACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-1755s21c1
Sequence:CCGGGCCAGAGCAGCCACCATAAATCTCGAGATTTATGGTGGCTGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-1334s21c1
Sequence:CCGGAGGTCCCAGGAACCCATATTTCTCGAGAAATATGGGTTCCTGGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001109809
ZFP57 MISSION shRNA Lentiviral Transduction Particles
ZFP57 zinc finger protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-565s21c1
Sequence:CCGGTGTTATGTCGGAAACCTTTAACTCGAGTTAAAGGTTTCCGACATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-1378s21c1
Sequence:CCGGGAACCAGGCATCTGTACTTAACTCGAGTTAAGTACAGATGCCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-1604s21c1
Sequence:GTACCGGAGCAAGTCTTTCAGCTCATTTCTCGAGAAATGAGCTGAAAGACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-1755s21c1
Sequence:CCGGGCCAGAGCAGCCACCATAAATCTCGAGATTTATGGTGGCTGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109809.1-1334s21c1
Sequence:CCGGAGGTCCCAGGAACCCATATTTCTCGAGAAATATGGGTTCCTGGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks