EMAIL THIS PAGE TO A FRIEND

ZFP62

ZFP62 zinc finger protein

Synonyms: ZET ZNF755
Gene ID:
Mouse(22720) zinc finger protein 62
cow(538928) ZFP62 zinc finger protein
sheep(101110143) zinc finger protein 62 homolog (mouse)
domestic guinea pig(100718779) ZFP62 zinc finger protein
dog(491673) zinc finger protein 62 homolog (mouse)
domestic cat(101082288) zinc finger protein 62 homolog (mouse)
Horse(100066374) zinc finger protein 62 homolog (mouse)
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_929517 Rosetta Predictions human pricing
XM_933728 Rosetta Predictions human pricing
XM_933732 Rosetta Predictions human pricing
XM_933736 Rosetta Predictions human pricing
XR_017332 Rosetta Predictions human pricing
NM_001024846 Rosetta Predictions mouse pricing
NM_009562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261595 predicted 2579
2 SASI_Hs01_00261596 predicted 909
3 SASI_Hs01_00261597 predicted 3055
4 SASI_Hs01_00261598 predicted 2138
5 SASI_Hs01_00261599 predicted 3390
6 SASI_Hs01_00261600 predicted 2021
7 SASI_Hs01_00261601 predicted 3190
8 SASI_Hs01_00261602 predicted 2651
9 SASI_Hs01_00261603 predicted 798
10 SASI_Hs01_00261604 predicted 2054
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259696 predicted 2505
2 SASI_Hs01_00259697 predicted 2031
3 SASI_Hs01_00259698 predicted 359
4 SASI_Hs01_00259699 predicted 1582
5 SASI_Hs01_00259700 predicted 2580
6 SASI_Hs01_00259701 predicted 1469
7 SASI_Hs01_00259702 predicted 2517
8 SASI_Hs01_00259703 predicted 2526
9 SASI_Hs01_00259704 predicted 2485
10 SASI_Hs01_00259705 predicted 2100
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255591 predicted 2016
2 SASI_Hs01_00255592 predicted 1052
3 SASI_Hs01_00255593 predicted 1111
4 SASI_Hs01_00255594 predicted 2100
5 SASI_Hs01_00255595 predicted 2036
6 SASI_Hs01_00255596 predicted 1032
7 SASI_Hs01_00255597 predicted 2046
8 SASI_Hs01_00255598 predicted 1999
9 SASI_Hs01_00255599 predicted 942
10 SASI_Hs01_00255600 predicted 1788
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276474 predicted 796
2 SASI_Hs01_00276475 predicted 1267
3 SASI_Hs01_00276476 predicted 1485
4 SASI_Hs01_00276477 predicted 1629
5 SASI_Hs01_00276478 predicted 1600
6 SASI_Hs01_00276479 predicted 524
7 SASI_Hs01_00276480 predicted 1394
8 SASI_Hs01_00276481 predicted 859
9 SASI_Hs01_00276482 predicted 443
10 SASI_Hs01_00276483 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00492838 predicted 3484
2 SASI_Hs02_00492839 predicted 2424
3 SASI_Hs02_00492840 predicted 1497
4 SASI_Hs02_00492841 predicted 2758
5 SASI_Hs02_00492842 predicted 1387
6 SASI_Hs02_00492843 predicted 3505
7 SASI_Hs02_00492844 predicted 3470
8 SASI_Hs02_00492845 predicted 2910
9 SASI_Hs02_00492846 predicted 2555
10 SASI_Hs02_00492847 predicted 2014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166561 predicted 1617
2 SASI_Mm01_00166562 predicted 2853
3 SASI_Mm02_00287723 predicted 1756
4 SASI_Mm01_00166563 predicted 1874
5 SASI_Mm02_00287724 predicted 2252
6 SASI_Mm01_00166564 predicted 1689
7 SASI_Mm01_00166565 predicted 2781
8 SASI_Mm01_00166566 predicted 2501
9 SASI_Mm02_00287725 predicted 2334
10 SASI_Mm01_00166568 predicted 612
11 SASI_Mm01_00166567 predicted 917
12 SASI_Mm01_00166569 predicted 652
13 SASI_Mm01_00166570 predicted 1881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176880 predicted 1515
2 SASI_Mm01_00176881 predicted 2745
3 SASI_Mm02_00316419 predicted 1654
4 SASI_Mm01_00176882 predicted 1771
5 SASI_Mm02_00316420 predicted 2155
6 SASI_Mm01_00176883 predicted 1591
7 SASI_Mm01_00176884 predicted 2678
8 SASI_Mm01_00176885 predicted 2407
9 SASI_Mm02_00316421 predicted 2233
10 SASI_Mm01_00176887 predicted 513
11 SASI_Mm01_00176886 predicted 812
12 SASI_Mm01_00176888 predicted 546
13 SASI_Mm01_00176889 predicted 1780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009562
VALIDATED
ZFP62 MISSION shRNA Bacterial Glycerol Stock
ZFP62 zinc finger protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009562.1-2683s1c1
Sequence:CCGGCGTGGAAAGCAGCCCTATAATCTCGAGATTATAGGGCTGCTTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009562.1-2357s1c1
Sequence:CCGGCGTCCTATACATGTGATGAATCTCGAGATTCATCACATGTATAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009562.1-495s1c1
Sequence:CCGGCACACATACAAACGCAGCAAACTCGAGTTTGCTGCGTTTGTATGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009562.1-1781s1c1
Sequence:CCGGGCAGCTATTGTGAGAAATCTTCTCGAGAAGATTTCTCACAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009562.1-1901s1c1
Sequence:CCGGGCCTTAAAGTACATAAGCGAACTCGAGTTCGCTTATGTACTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009562.2-1602s21c1
Sequence:CCGGATCTCACGCTCAAGCCTTAAACTCGAGTTTAAGGCTTGAGCGTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009562.2-3034s21c1
Sequence:CCGGGTCGAACACTTTAGGACTATACTCGAGTATAGTCCTAAAGTGTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009562.2-529s21c1
Sequence:CCGGACGTACACCCTGCTCATATTGCTCGAGCAATATGAGCAGGGTGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009562.2-1855s21c1
Sequence:CCGGTCTCACTCTCAAGCCTTATAACTCGAGTTATAAGGCTTGAGAGTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009562
VALIDATED
ZFP62 MISSION shRNA shRNA Plasmid DNA
ZFP62 zinc finger protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009562.1-2683s1c1
Sequence:CCGGCGTGGAAAGCAGCCCTATAATCTCGAGATTATAGGGCTGCTTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009562.1-2357s1c1
Sequence:CCGGCGTCCTATACATGTGATGAATCTCGAGATTCATCACATGTATAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009562.1-495s1c1
Sequence:CCGGCACACATACAAACGCAGCAAACTCGAGTTTGCTGCGTTTGTATGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009562.1-1781s1c1
Sequence:CCGGGCAGCTATTGTGAGAAATCTTCTCGAGAAGATTTCTCACAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009562.1-1901s1c1
Sequence:CCGGGCCTTAAAGTACATAAGCGAACTCGAGTTCGCTTATGTACTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009562.2-1602s21c1
Sequence:CCGGATCTCACGCTCAAGCCTTAAACTCGAGTTTAAGGCTTGAGCGTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009562.2-3034s21c1
Sequence:CCGGGTCGAACACTTTAGGACTATACTCGAGTATAGTCCTAAAGTGTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009562.2-529s21c1
Sequence:CCGGACGTACACCCTGCTCATATTGCTCGAGCAATATGAGCAGGGTGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009562.2-1855s21c1
Sequence:CCGGTCTCACTCTCAAGCCTTATAACTCGAGTTATAAGGCTTGAGAGTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009562
VALIDATED
ZFP62 MISSION shRNA Lentiviral Transduction Particles
ZFP62 zinc finger protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009562.1-2683s1c1
Sequence:CCGGCGTGGAAAGCAGCCCTATAATCTCGAGATTATAGGGCTGCTTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009562.1-2357s1c1
Sequence:CCGGCGTCCTATACATGTGATGAATCTCGAGATTCATCACATGTATAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009562.1-495s1c1
Sequence:CCGGCACACATACAAACGCAGCAAACTCGAGTTTGCTGCGTTTGTATGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009562.1-1781s1c1
Sequence:CCGGGCAGCTATTGTGAGAAATCTTCTCGAGAAGATTTCTCACAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009562.1-1901s1c1
Sequence:CCGGGCCTTAAAGTACATAAGCGAACTCGAGTTCGCTTATGTACTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009562.2-1602s21c1
Sequence:CCGGATCTCACGCTCAAGCCTTAAACTCGAGTTTAAGGCTTGAGCGTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009562.2-3034s21c1
Sequence:CCGGGTCGAACACTTTAGGACTATACTCGAGTATAGTCCTAAAGTGTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009562.2-529s21c1
Sequence:CCGGACGTACACCCTGCTCATATTGCTCGAGCAATATGAGCAGGGTGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009562.2-1855s21c1
Sequence:CCGGTCTCACTCTCAAGCCTTATAACTCGAGTTATAAGGCTTGAGAGTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks