EMAIL THIS PAGE TO A FRIEND

ZFP64

ZFP64 zinc finger protein

Synonyms: ZNF338
Gene ID:
Mouse(22722) zinc finger protein 64
Rat(311661) zinc finger protein 64
cow(539018) zinc finger protein 64 homolog (mouse)
sheep(101120007) zinc finger protein 64 homolog (mouse)
domestic guinea pig(100728492) ZFP64 zinc finger protein
naked mole-rat(101719653) ZFP64 zinc finger protein
Domestic Rabbit(100351106) zinc finger protein 64 homolog (mouse)
Zebrafish(100003733) zinc finger protein 64 homolog (mouse)
domestic cat(101097135) zinc finger protein 64 homolog (mouse)
Horse(100052970) zinc finger protein 64 homolog (mouse)
dog(485932) zinc finger protein 64 homolog (mouse)
chicken(419342) zinc finger protein 64 homolog (mouse)
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018197 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018197 Rosetta Predictions human pricing
NM_022088 Rosetta Predictions human pricing
NM_199426 Rosetta Predictions human pricing
NM_199427 Rosetta Predictions human pricing
NM_001012093 Rosetta Predictions rat pricing
XM_575290 Rosetta Predictions rat pricing
NM_009564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031828 predicted 1065
2 SASI_Hs01_00031830 predicted 1611
3 SASI_Hs01_00031831 predicted 1452
4 SASI_Hs01_00031833 predicted 1964
5 SASI_Hs01_00031834 predicted 1263
6 SASI_Hs02_00351479 predicted 1723
7 SASI_Hs01_00031835 predicted 2193
8 SASI_Hs01_00031836 predicted 1714
9 SASI_Hs02_00351480 predicted 1445
10 SASI_Hs02_00351481 predicted 1259
11 SASI_Hs01_00031829 predicted 1210
12 SASI_Hs01_00031832 predicted 1539
13 SASI_Hs01_00031837 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157721 predicted 905
2 SASI_Hs01_00157723 predicted 1446
3 SASI_Hs01_00157724 predicted 1288
4 SASI_Hs01_00157726 predicted 1802
5 SASI_Hs01_00157727 predicted 1104
6 SASI_Hs02_00355468 predicted 1553
7 SASI_Hs01_00157728 predicted 2029
8 SASI_Hs01_00157729 predicted 1555
9 SASI_Hs02_00355469 predicted 1292
10 SASI_Hs02_00355470 predicted 1092
11 SASI_Hs01_00157722 predicted 1045
12 SASI_Hs01_00157725 predicted 1381
13 SASI_Hs01_00157730 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107560 predicted 1063
2 SASI_Hs01_00107562 predicted 1609
3 SASI_Hs01_00107563 predicted 1447
4 SASI_Hs01_00107565 predicted 1963
5 SASI_Hs01_00107566 predicted 1262
6 SASI_Hs02_00372826 predicted 1712
7 SASI_Hs01_00107567 predicted 2186
8 SASI_Hs01_00107568 predicted 1702
9 SASI_Hs02_00372827 predicted 1440
10 SASI_Hs02_00372828 predicted 1246
11 SASI_Hs01_00107561 predicted 1200
12 SASI_Hs01_00107564 predicted 1538
13 SASI_Hs01_00107569 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152279 predicted 604
2 SASI_Hs01_00152280 predicted 826
3 SASI_Hs01_00152281 predicted 888
4 SASI_Hs01_00152282 predicted 620
5 SASI_Hs01_00152283 predicted 769
6 SASI_Hs01_00152284 predicted 887
7 SASI_Hs01_00152286 predicted 675
8 SASI_Hs01_00152287 predicted 784
9 SASI_Hs01_00152288 predicted 694
10 SASI_Hs02_00372829 predicted 770
11 SASI_Hs01_00152285 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081735 predicted 1417
2 SASI_Rn02_00200226 predicted 2007
3 SASI_Rn01_00081737 predicted 197
4 SASI_Rn01_00081738 predicted 2095
5 SASI_Rn01_00081739 predicted 1909
6 SASI_Rn01_00081740 predicted 1054
7 SASI_Rn01_00081741 predicted 1915
8 SASI_Rn01_00081742 predicted 353
9 SASI_Rn01_00081743 predicted 370
10 SASI_Rn01_00081744 predicted 336
11 SASI_Rn01_00081736 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143531 predicted 1268
2 SASI_Rn01_00143532 predicted 1455
3 SASI_Rn01_00143533 predicted 1225
4 SASI_Rn01_00143534 predicted 1937
5 SASI_Rn01_00143535 predicted 1920
6 SASI_Rn01_00143536 predicted 1954
7 SASI_Rn01_00143537 predicted 1297
8 SASI_Rn01_00143538 predicted 1976
9 SASI_Rn01_00143539 predicted 2070
10 SASI_Rn01_00143540 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316422 predicted 1269
2 SASI_Mm02_00316423 predicted 2433
3 SASI_Mm02_00316424 predicted 713
4 SASI_Mm02_00316425 predicted 2258
5 SASI_Mm02_00316426 predicted 1114
6 SASI_Mm02_00316427 predicted 507
7 SASI_Mm02_00316428 predicted 2469
8 SASI_Mm02_00316429 predicted 2251
9 SASI_Mm02_00316430 predicted 704
10 SASI_Mm02_00316431 predicted 2347
11 SASI_Mm01_00074769 predicted 472
12 SASI_Mm01_00074770 predicted 1232
13 SASI_Mm01_00074771 predicted 566
14 SASI_Mm01_00074772 predicted 1194
15 SASI_Mm01_00074773 predicted 358
16 SASI_Mm01_00074774 predicted 1694
17 SASI_Mm01_00074775 predicted 335
18 SASI_Mm01_00074776 predicted 554
19 SASI_Mm01_00074777 predicted 1379
20 SASI_Mm01_00074778 predicted 1371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009564
VALIDATED
ZFP64 MISSION shRNA Bacterial Glycerol Stock
ZFP64 zinc finger protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009564.2-706s21c1
Sequence:CCGGTCAGCTCCAGAGTTCGTCTTTCTCGAGAAAGACGAACTCTGGAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009564.2-1701s21c1
Sequence:CCGGCATCTGTGACGCCTCGTTTATCTCGAGATAAACGAGGCGTCACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009564.2-2042s21c1
Sequence:CCGGTTCGCCAGGTCAGTCTCATTGCTCGAGCAATGAGACTGACCTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009564.2-2595s21c1
Sequence:CCGGGCTCTTGTTGATTGTGTCTTACTCGAGTAAGACACAATCAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009564.2-1783s21c1
Sequence:CCGGGACGTGACTGTAGTACAGCTTCTCGAGAAGCTGTACTACAGTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-2265s1c1
Sequence:CCGGGCTCTTGTTGATTGTGTCTTACTCGAGTAAGACACAATCAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-381s1c1
Sequence:CCGGGCTCCAGAGTTCGTCTTTGAACTCGAGTTCAAAGACGAACTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-378s1c1
Sequence:CCGGTCAGCTCCAGAGTTCGTCTTTCTCGAGAAAGACGAACTCTGGAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-1455s1c1
Sequence:CCGGGACGTGACTGTAGTACAGCTTCTCGAGAAGCTGTACTACAGTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-530s1c1
Sequence:CCGGCTATCCAGGTTGCCAGTTCAACTCGAGTTGAACTGGCAACCTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009564
VALIDATED
ZFP64 MISSION shRNA shRNA Plasmid DNA
ZFP64 zinc finger protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009564.2-706s21c1
Sequence:CCGGTCAGCTCCAGAGTTCGTCTTTCTCGAGAAAGACGAACTCTGGAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009564.2-1701s21c1
Sequence:CCGGCATCTGTGACGCCTCGTTTATCTCGAGATAAACGAGGCGTCACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009564.2-2042s21c1
Sequence:CCGGTTCGCCAGGTCAGTCTCATTGCTCGAGCAATGAGACTGACCTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009564.2-2595s21c1
Sequence:CCGGGCTCTTGTTGATTGTGTCTTACTCGAGTAAGACACAATCAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009564.2-1783s21c1
Sequence:CCGGGACGTGACTGTAGTACAGCTTCTCGAGAAGCTGTACTACAGTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-2265s1c1
Sequence:CCGGGCTCTTGTTGATTGTGTCTTACTCGAGTAAGACACAATCAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-381s1c1
Sequence:CCGGGCTCCAGAGTTCGTCTTTGAACTCGAGTTCAAAGACGAACTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-378s1c1
Sequence:CCGGTCAGCTCCAGAGTTCGTCTTTCTCGAGAAAGACGAACTCTGGAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-1455s1c1
Sequence:CCGGGACGTGACTGTAGTACAGCTTCTCGAGAAGCTGTACTACAGTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-530s1c1
Sequence:CCGGCTATCCAGGTTGCCAGTTCAACTCGAGTTGAACTGGCAACCTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009564
VALIDATED
ZFP64 MISSION shRNA Lentiviral Transduction Particles
ZFP64 zinc finger protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009564.2-706s21c1
Sequence:CCGGTCAGCTCCAGAGTTCGTCTTTCTCGAGAAAGACGAACTCTGGAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009564.2-1701s21c1
Sequence:CCGGCATCTGTGACGCCTCGTTTATCTCGAGATAAACGAGGCGTCACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009564.2-2042s21c1
Sequence:CCGGTTCGCCAGGTCAGTCTCATTGCTCGAGCAATGAGACTGACCTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009564.2-2595s21c1
Sequence:CCGGGCTCTTGTTGATTGTGTCTTACTCGAGTAAGACACAATCAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009564.2-1783s21c1
Sequence:CCGGGACGTGACTGTAGTACAGCTTCTCGAGAAGCTGTACTACAGTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-2265s1c1
Sequence:CCGGGCTCTTGTTGATTGTGTCTTACTCGAGTAAGACACAATCAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-381s1c1
Sequence:CCGGGCTCCAGAGTTCGTCTTTGAACTCGAGTTCAAAGACGAACTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-378s1c1
Sequence:CCGGTCAGCTCCAGAGTTCGTCTTTCTCGAGAAAGACGAACTCTGGAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-1455s1c1
Sequence:CCGGGACGTGACTGTAGTACAGCTTCTCGAGAAGCTGTACTACAGTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009564.1-530s1c1
Sequence:CCGGCTATCCAGGTTGCCAGTTCAACTCGAGTTGAACTGGCAACCTGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018197
VALIDATED
ZFP64 MISSION shRNA Bacterial Glycerol Stock
ZFP64 zinc finger protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018197.2-424s21c1
Sequence:CCGGGCTGACTCCCGACATCCATATCTCGAGATATGGATGTCGGGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018197.2-1618s21c1
Sequence:CCGGGAGTTTCCACTGCGATATATGCTCGAGCATATATCGCAGTGGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018197.2-2888s21c1
Sequence:CCGGCTCTGAATCGTCGCATTATAACTCGAGTTATAATGCGACGATTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018197.2-2158s21c1
Sequence:CCGGCATTACCAGTTCGGGTATTACCTCGAGGTAATACCCGAACTGGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018197.2-1270s21c1
Sequence:CCGGTATCAAGCACAGCGGGAATAACTCGAGTTATTCCCGCTGTGCTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018197.2-2142s1c1
Sequence:CCGGCTGGCAATCAAACTTTCATTACTCGAGTAATGAAAGTTTGATTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018197.2-1453s1c1
Sequence:CCGGCCGCCCTTTCAAGTGCAACTACTCGAGTAGTTGCACTTGAAAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_018197.2-800s1c1
Sequence:CCGGTGCCAATTCAAGACTGCTTATCTCGAGATAAGCAGTCTTGAATTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018197.2-2771s1c1
Sequence:CCGGCGTGGTTTGCTCTTAATGTTTCTCGAGAAACATTAAGAGCAAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018197.2-2145s1c1
Sequence:CCGGGCAATCAAACTTTCATTACCACTCGAGTGGTAATGAAAGTTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018197
VALIDATED
ZFP64 MISSION shRNA shRNA Plasmid DNA
ZFP64 zinc finger protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018197.2-424s21c1
Sequence:CCGGGCTGACTCCCGACATCCATATCTCGAGATATGGATGTCGGGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018197.2-1618s21c1
Sequence:CCGGGAGTTTCCACTGCGATATATGCTCGAGCATATATCGCAGTGGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018197.2-2888s21c1
Sequence:CCGGCTCTGAATCGTCGCATTATAACTCGAGTTATAATGCGACGATTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018197.2-2158s21c1
Sequence:CCGGCATTACCAGTTCGGGTATTACCTCGAGGTAATACCCGAACTGGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018197.2-1270s21c1
Sequence:CCGGTATCAAGCACAGCGGGAATAACTCGAGTTATTCCCGCTGTGCTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018197.2-2142s1c1
Sequence:CCGGCTGGCAATCAAACTTTCATTACTCGAGTAATGAAAGTTTGATTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018197.2-1453s1c1
Sequence:CCGGCCGCCCTTTCAAGTGCAACTACTCGAGTAGTTGCACTTGAAAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_018197.2-800s1c1
Sequence:CCGGTGCCAATTCAAGACTGCTTATCTCGAGATAAGCAGTCTTGAATTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018197.2-2771s1c1
Sequence:CCGGCGTGGTTTGCTCTTAATGTTTCTCGAGAAACATTAAGAGCAAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018197.2-2145s1c1
Sequence:CCGGGCAATCAAACTTTCATTACCACTCGAGTGGTAATGAAAGTTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018197
VALIDATED
ZFP64 MISSION shRNA Lentiviral Transduction Particles
ZFP64 zinc finger protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018197.2-424s21c1
Sequence:CCGGGCTGACTCCCGACATCCATATCTCGAGATATGGATGTCGGGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018197.2-1618s21c1
Sequence:CCGGGAGTTTCCACTGCGATATATGCTCGAGCATATATCGCAGTGGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018197.2-2888s21c1
Sequence:CCGGCTCTGAATCGTCGCATTATAACTCGAGTTATAATGCGACGATTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018197.2-2158s21c1
Sequence:CCGGCATTACCAGTTCGGGTATTACCTCGAGGTAATACCCGAACTGGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018197.2-1270s21c1
Sequence:CCGGTATCAAGCACAGCGGGAATAACTCGAGTTATTCCCGCTGTGCTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018197.2-2142s1c1
Sequence:CCGGCTGGCAATCAAACTTTCATTACTCGAGTAATGAAAGTTTGATTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018197.2-1453s1c1
Sequence:CCGGCCGCCCTTTCAAGTGCAACTACTCGAGTAGTTGCACTTGAAAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_018197.2-800s1c1
Sequence:CCGGTGCCAATTCAAGACTGCTTATCTCGAGATAAGCAGTCTTGAATTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018197.2-2771s1c1
Sequence:CCGGCGTGGTTTGCTCTTAATGTTTCTCGAGAAACATTAAGAGCAAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018197.2-2145s1c1
Sequence:CCGGGCAATCAAACTTTCATTACCACTCGAGTGGTAATGAAAGTTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks