EMAIL THIS PAGE TO A FRIEND

ZFP69

ZFP69 zinc finger protein

Synonyms: RP11-656D10.2 ZFP69A ZKSCAN23A ZNF642 ZSCAN54A
UniProtKB ID: Q49AA0, Q5SWM5, Q6ZWK8
Gene ID:
Mouse(381549) zinc finger protein 69
Rat(100363455) zinc finger protein 69
domestic guinea pig(100725795) ZFP69 zinc finger protein
naked mole-rat(101721720) ZFP69 zinc finger protein
cow(521549) zinc finger protein 642
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198494 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198494 Rosetta Predictions human pricing
NM_001005788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196501 predicted 1718
2 SASI_Hs01_00196502 predicted 795
3 SASI_Hs01_00196503 predicted 1295
4 SASI_Hs01_00196505 predicted 1541
5 SASI_Hs01_00196506 predicted 1388
6 SASI_Hs01_00196507 predicted 1641
7 SASI_Hs01_00196508 predicted 1220
8 SASI_Hs01_00196509 predicted 1912
9 SASI_Hs02_00372064 predicted 836
10 SASI_Hs01_00196510 predicted 1681
11 SASI_Hs01_00196504 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074759 predicted 498
2 SASI_Mm01_00074760 predicted 888
3 SASI_Mm02_00286655 predicted 1401
4 SASI_Mm01_00074761 predicted 1389
5 SASI_Mm01_00074762 predicted 1637
6 SASI_Mm01_00074763 predicted 1527
7 SASI_Mm01_00074764 predicted 951
8 SASI_Mm01_00074765 predicted 1643
9 SASI_Mm01_00074766 predicted 724
10 SASI_Mm01_00074768 predicted 936
11 SASI_Mm01_00074767 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005788
ZFP69 MISSION shRNA Bacterial Glycerol Stock
ZFP69 zinc finger protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000096154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005788.1-1781s1c1
Sequence:CCGGCGAGTAACCTTGAGAAATTAACTCGAGTTAATTTCTCAAGGTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005788.1-944s1c1
Sequence:CCGGGCCAGAAGGTACCCATGTAATCTCGAGATTACATGGGTACCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005788.1-1573s1c1
Sequence:CCGGGCACGACTCCTCCTTTAAGAACTCGAGTTCTTAAAGGAGGAGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005788.1-514s1c1
Sequence:CCGGGCCTACTGTGATTTCCCAGTTCTCGAGAACTGGGAAATCACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005788
ZFP69 MISSION shRNA shRNA Plasmid DNA
ZFP69 zinc finger protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000096154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005788.1-1781s1c1
Sequence:CCGGCGAGTAACCTTGAGAAATTAACTCGAGTTAATTTCTCAAGGTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005788.1-944s1c1
Sequence:CCGGGCCAGAAGGTACCCATGTAATCTCGAGATTACATGGGTACCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005788.1-1573s1c1
Sequence:CCGGGCACGACTCCTCCTTTAAGAACTCGAGTTCTTAAAGGAGGAGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005788.1-514s1c1
Sequence:CCGGGCCTACTGTGATTTCCCAGTTCTCGAGAACTGGGAAATCACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005788
ZFP69 MISSION shRNA Lentiviral Transduction Particles
ZFP69 zinc finger protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000096154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005788.1-1781s1c1
Sequence:CCGGCGAGTAACCTTGAGAAATTAACTCGAGTTAATTTCTCAAGGTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005788.1-944s1c1
Sequence:CCGGGCCAGAAGGTACCCATGTAATCTCGAGATTACATGGGTACCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005788.1-1573s1c1
Sequence:CCGGGCACGACTCCTCCTTTAAGAACTCGAGTTCTTAAAGGAGGAGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005788.1-514s1c1
Sequence:CCGGGCCTACTGTGATTTCCCAGTTCTCGAGAACTGGGAAATCACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198494
ZFP69 MISSION shRNA Bacterial Glycerol Stock
ZFP69 zinc finger protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-795s1c1
Sequence:CCGGGCGCTTATATCATGGCATTATCTCGAGATAATGCCATGATATAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-1481s1c1
Sequence:CCGGGACACCTTAGTGAACATATAACTCGAGTTATATGTTCACTAAGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-658s1c1
Sequence:CCGGCCTAGTGTGATATCCCAGTTACTCGAGTAACTGGGATATCACACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-1641s1c1
Sequence:CCGGGCAGAGGATACACCTTAGCAACTCGAGTTGCTAAGGTGTATCCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-510s1c1
Sequence:CCGGCCAGGAATTGTTGACTTTCAACTCGAGTTGAAAGTCAACAATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198494.2-1554s21c1
Sequence:CCGGTAGTCATAGAGCGTATCTAACCTCGAGGTTAGATACGCTCTATGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198494.2-1848s21c1
Sequence:CCGGGAGGAACGCCTTCCGAAATAACTCGAGTTATTTCGGAAGGCGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198494.2-633s21c1
Sequence:CCGGGTCAGTGGGATATCAACTTTCCTCGAGGAAAGTTGATATCCCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198494.2-924s21c1
Sequence:CCGGACAAGCCATCTTGACCCATAACTCGAGTTATGGGTCAAGATGGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198494
ZFP69 MISSION shRNA shRNA Plasmid DNA
ZFP69 zinc finger protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-795s1c1
Sequence:CCGGGCGCTTATATCATGGCATTATCTCGAGATAATGCCATGATATAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-1481s1c1
Sequence:CCGGGACACCTTAGTGAACATATAACTCGAGTTATATGTTCACTAAGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-658s1c1
Sequence:CCGGCCTAGTGTGATATCCCAGTTACTCGAGTAACTGGGATATCACACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-1641s1c1
Sequence:CCGGGCAGAGGATACACCTTAGCAACTCGAGTTGCTAAGGTGTATCCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-510s1c1
Sequence:CCGGCCAGGAATTGTTGACTTTCAACTCGAGTTGAAAGTCAACAATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198494.2-1554s21c1
Sequence:CCGGTAGTCATAGAGCGTATCTAACCTCGAGGTTAGATACGCTCTATGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198494.2-1848s21c1
Sequence:CCGGGAGGAACGCCTTCCGAAATAACTCGAGTTATTTCGGAAGGCGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198494.2-633s21c1
Sequence:CCGGGTCAGTGGGATATCAACTTTCCTCGAGGAAAGTTGATATCCCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198494.2-924s21c1
Sequence:CCGGACAAGCCATCTTGACCCATAACTCGAGTTATGGGTCAAGATGGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198494
ZFP69 MISSION shRNA Lentiviral Transduction Particles
ZFP69 zinc finger protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-795s1c1
Sequence:CCGGGCGCTTATATCATGGCATTATCTCGAGATAATGCCATGATATAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-1481s1c1
Sequence:CCGGGACACCTTAGTGAACATATAACTCGAGTTATATGTTCACTAAGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-658s1c1
Sequence:CCGGCCTAGTGTGATATCCCAGTTACTCGAGTAACTGGGATATCACACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-1641s1c1
Sequence:CCGGGCAGAGGATACACCTTAGCAACTCGAGTTGCTAAGGTGTATCCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198494.1-510s1c1
Sequence:CCGGCCAGGAATTGTTGACTTTCAACTCGAGTTGAAAGTCAACAATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198494.2-1554s21c1
Sequence:CCGGTAGTCATAGAGCGTATCTAACCTCGAGGTTAGATACGCTCTATGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198494.2-1848s21c1
Sequence:CCGGGAGGAACGCCTTCCGAAATAACTCGAGTTATTTCGGAAGGCGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198494.2-633s21c1
Sequence:CCGGGTCAGTGGGATATCAACTTTCCTCGAGGAAAGTTGATATCCCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198494.2-924s21c1
Sequence:CCGGACAAGCCATCTTGACCCATAACTCGAGTTATGGGTCAAGATGGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks