EMAIL THIS PAGE TO A FRIEND

ZFP69B

ZFP69 zinc finger protein B

Synonyms: RP11-656D10.1 ZKSCAN23B ZNF643 ZSCAN54B
UniProtKB ID: Q9UJL9, Q5QPL4
Gene ID:
cow(100139424) ZFP69 zinc finger protein B
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023070 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023070 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048070 predicted 1076
2 SASI_Hs01_00048071 predicted 1066
3 SASI_Hs01_00048072 predicted 1362
4 SASI_Hs01_00048073 predicted 1422
5 SASI_Hs01_00048074 predicted 947
6 SASI_Hs01_00048075 predicted 1415
7 SASI_Hs01_00048076 predicted 995
8 SASI_Hs01_00048077 predicted 1060
9 SASI_Hs01_00048078 predicted 772
10 SASI_Hs02_00356308 predicted 946
11 SASI_Hs01_00048079 predicted 753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023070
VALIDATED
ZFP69B MISSION shRNA Bacterial Glycerol Stock
ZFP69 zinc finger protein B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_023070.1-1650s1c1
Sequence:CCGGGCCAGAGAATACATCTTTCTACTCGAGTAGAAAGATGTATTCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023070.1-629s1c1
Sequence:CCGGCTTTCCAAACCTGGCGTGATTCTCGAGAATCACGCCAGGTTTGGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-1081s21c1
Sequence:CCGGTAATCATTCAAGGAGTTATACCTCGAGGTATAACTCCTTGAATGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-1324s21c1
Sequence:GTACCGGATCGCTTACTCAACATGTTAGCTCGAGCTAACATGTTGAGTAAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-940s21c1
Sequence:CCGGGAGAGGCCAAGAGTCTAATAGCTCGAGCTATTAGACTCTTGGCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-630s21c1
Sequence:CCGGTTTCCAAACCTGGCGTGATTTCTCGAGAAATCACGCCAGGTTTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-747s21c1
Sequence:CCGGCAGCCTTACAGAATGATATTTCTCGAGAAATATCATTCTGTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023070
VALIDATED
ZFP69B MISSION shRNA shRNA Plasmid DNA
ZFP69 zinc finger protein B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_023070.1-1650s1c1
Sequence:CCGGGCCAGAGAATACATCTTTCTACTCGAGTAGAAAGATGTATTCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023070.1-629s1c1
Sequence:CCGGCTTTCCAAACCTGGCGTGATTCTCGAGAATCACGCCAGGTTTGGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-1081s21c1
Sequence:CCGGTAATCATTCAAGGAGTTATACCTCGAGGTATAACTCCTTGAATGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-1324s21c1
Sequence:GTACCGGATCGCTTACTCAACATGTTAGCTCGAGCTAACATGTTGAGTAAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-940s21c1
Sequence:CCGGGAGAGGCCAAGAGTCTAATAGCTCGAGCTATTAGACTCTTGGCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-630s21c1
Sequence:CCGGTTTCCAAACCTGGCGTGATTTCTCGAGAAATCACGCCAGGTTTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-747s21c1
Sequence:CCGGCAGCCTTACAGAATGATATTTCTCGAGAAATATCATTCTGTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023070
VALIDATED
ZFP69B MISSION shRNA Lentiviral Transduction Particles
ZFP69 zinc finger protein B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_023070.1-1650s1c1
Sequence:CCGGGCCAGAGAATACATCTTTCTACTCGAGTAGAAAGATGTATTCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023070.1-629s1c1
Sequence:CCGGCTTTCCAAACCTGGCGTGATTCTCGAGAATCACGCCAGGTTTGGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-1081s21c1
Sequence:CCGGTAATCATTCAAGGAGTTATACCTCGAGGTATAACTCCTTGAATGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-1324s21c1
Sequence:GTACCGGATCGCTTACTCAACATGTTAGCTCGAGCTAACATGTTGAGTAAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-940s21c1
Sequence:CCGGGAGAGGCCAAGAGTCTAATAGCTCGAGCTATTAGACTCTTGGCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-630s21c1
Sequence:CCGGTTTCCAAACCTGGCGTGATTTCTCGAGAAATCACGCCAGGTTTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023070.1-747s21c1
Sequence:CCGGCAGCCTTACAGAATGATATTTCTCGAGAAATATCATTCTGTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks