EMAIL THIS PAGE TO A FRIEND

ZFP82

ZFP82 zinc finger protein

Synonyms: ZNF545
UniProtKB ID: Q8N141, Q8NC63, Q8TF53
Gene ID:
Mouse(330502) zinc finger protein 82
domestic guinea pig(100728877) ZFP82 zinc finger protein
naked mole-rat(101722014) ZFP82 zinc finger protein
cow(100847996) ZFP82 zinc finger protein
sheep(101102665) zinc finger protein 82 homolog (mouse)
domestic cat(101085512) zinc finger protein 82 homolog (mouse)
dog(100855951) zinc finger protein 82 homolog (mouse)
Horse(100629880) zinc finger protein 82 homolog (mouse)
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133466 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133466 Rosetta Predictions human pricing
NM_177889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195623 predicted 476
2 SASI_Hs01_00195624 predicted 1348
3 SASI_Hs01_00195625 predicted 1355
4 SASI_Hs01_00195626 predicted 680
5 SASI_Hs01_00195627 predicted 1791
6 SASI_Hs01_00195628 predicted 1483
7 SASI_Hs01_00195629 predicted 1432
8 SASI_Hs01_00195630 predicted 1199
9 SASI_Hs01_00195631 predicted 315
10 SASI_Hs01_00195632 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156093 predicted 803
2 SASI_Mm01_00156094 predicted 1322
3 SASI_Mm01_00156095 predicted 1798
4 SASI_Mm02_00348374 predicted 428
5 SASI_Mm01_00156096 predicted 823
6 SASI_Mm01_00156097 predicted 1814
7 SASI_Mm01_00156098 predicted 493
8 SASI_Mm01_00156099 predicted 390
9 SASI_Mm01_00156101 predicted 1024
10 SASI_Mm01_00156102 predicted 788
11 SASI_Mm01_00156100 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177889
ZFP82 MISSION shRNA Bacterial Glycerol Stock
ZFP82 zinc finger protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177889.2-1146s1c1
Sequence:CCGGCCCACCACTGTAAGTTTCTTTCTCGAGAAAGAAACTTACAGTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177889.2-1648s1c1
Sequence:CCGGGCAAAGACTAAGGAAAGTAATCTCGAGATTACTTTCCTTAGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177889.2-904s1c1
Sequence:CCGGGCCATTTGTTATTTCTCTGTTCTCGAGAACAGAGAAATAACAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177889.2-1647s1c1
Sequence:CCGGCGCAAAGACTAAGGAAAGTAACTCGAGTTACTTTCCTTAGTCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-1278s21c1
Sequence:CCGGGACAGACTGTACGAGTGTAAACTCGAGTTTACACTCGTACAGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-1571s21c1
Sequence:CCGGTCGCTACTCACAGCTTATTTCCTCGAGGAAATAAGCTGTGAGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-1808s21c1
Sequence:CCGGTAGGAAGGCCTTTCGACTTAACTCGAGTTAAGTCGAAAGGCCTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-811s21c1
Sequence:CCGGCTTATGAGAAGCGCGCATTAACTCGAGTTAATGCGCGCTTCTCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-835s21c1
Sequence:CCGGCACGTCAGAGGATCCACTTTGCTCGAGCAAAGTGGATCCTCTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177889
ZFP82 MISSION shRNA shRNA Plasmid DNA
ZFP82 zinc finger protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177889.2-1146s1c1
Sequence:CCGGCCCACCACTGTAAGTTTCTTTCTCGAGAAAGAAACTTACAGTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177889.2-1648s1c1
Sequence:CCGGGCAAAGACTAAGGAAAGTAATCTCGAGATTACTTTCCTTAGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177889.2-904s1c1
Sequence:CCGGGCCATTTGTTATTTCTCTGTTCTCGAGAACAGAGAAATAACAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177889.2-1647s1c1
Sequence:CCGGCGCAAAGACTAAGGAAAGTAACTCGAGTTACTTTCCTTAGTCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-1278s21c1
Sequence:CCGGGACAGACTGTACGAGTGTAAACTCGAGTTTACACTCGTACAGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-1571s21c1
Sequence:CCGGTCGCTACTCACAGCTTATTTCCTCGAGGAAATAAGCTGTGAGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-1808s21c1
Sequence:CCGGTAGGAAGGCCTTTCGACTTAACTCGAGTTAAGTCGAAAGGCCTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-811s21c1
Sequence:CCGGCTTATGAGAAGCGCGCATTAACTCGAGTTAATGCGCGCTTCTCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-835s21c1
Sequence:CCGGCACGTCAGAGGATCCACTTTGCTCGAGCAAAGTGGATCCTCTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177889
ZFP82 MISSION shRNA Lentiviral Transduction Particles
ZFP82 zinc finger protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177889.2-1146s1c1
Sequence:CCGGCCCACCACTGTAAGTTTCTTTCTCGAGAAAGAAACTTACAGTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177889.2-1648s1c1
Sequence:CCGGGCAAAGACTAAGGAAAGTAATCTCGAGATTACTTTCCTTAGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177889.2-904s1c1
Sequence:CCGGGCCATTTGTTATTTCTCTGTTCTCGAGAACAGAGAAATAACAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177889.2-1647s1c1
Sequence:CCGGCGCAAAGACTAAGGAAAGTAACTCGAGTTACTTTCCTTAGTCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-1278s21c1
Sequence:CCGGGACAGACTGTACGAGTGTAAACTCGAGTTTACACTCGTACAGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-1571s21c1
Sequence:CCGGTCGCTACTCACAGCTTATTTCCTCGAGGAAATAAGCTGTGAGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-1808s21c1
Sequence:CCGGTAGGAAGGCCTTTCGACTTAACTCGAGTTAAGTCGAAAGGCCTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-811s21c1
Sequence:CCGGCTTATGAGAAGCGCGCATTAACTCGAGTTAATGCGCGCTTCTCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177889.4-835s21c1
Sequence:CCGGCACGTCAGAGGATCCACTTTGCTCGAGCAAAGTGGATCCTCTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133466
ZFP82 MISSION shRNA Bacterial Glycerol Stock
ZFP82 zinc finger protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-1523s1c1
Sequence:CCGGGCCTTCAGACTACTTTCACAACTCGAGTTGTGAAAGTAGTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-695s1c1
Sequence:CCGGCGCACATCTGTTACTCCACATCTCGAGATGTGGAGTAACAGATGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-424s1c1
Sequence:CCGGGCCTTGGAAAGTTGTGAGGAACTCGAGTTCCTCACAACTTTCCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-1154s1c1
Sequence:CCGGGACAGGCTCTATGAATGCAAACTCGAGTTTGCATTCATAGAGCCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-1031s1c1
Sequence:CCGGCGAGGACAACTTACTCTGCATCTCGAGATGCAGAGTAAGTTGTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133466.2-1360s21c1
Sequence:GTACCGGTAGCCGTGGTTATCATCTTATCTCGAGATAAGATGATAACCACGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133466.2-2073s21c1
Sequence:CCGGCATACTGGACAAGACGCTTAACTCGAGTTAAGCGTCTTGTCCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133466.2-1698s21c1
Sequence:CCGGGACTTAATTCATCCCTTATTCCTCGAGGAATAAGGGATGAATTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133466.2-1519s21c1
Sequence:CCGGGAAGGCCTTCAGACTACTTTCCTCGAGGAAAGTAGTCTGAAGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133466.2-1128s21c1
Sequence:CCGGCTCGGCATCAGAAGCTTAATACTCGAGTATTAAGCTTCTGATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133466
ZFP82 MISSION shRNA shRNA Plasmid DNA
ZFP82 zinc finger protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-1523s1c1
Sequence:CCGGGCCTTCAGACTACTTTCACAACTCGAGTTGTGAAAGTAGTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-695s1c1
Sequence:CCGGCGCACATCTGTTACTCCACATCTCGAGATGTGGAGTAACAGATGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-424s1c1
Sequence:CCGGGCCTTGGAAAGTTGTGAGGAACTCGAGTTCCTCACAACTTTCCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-1154s1c1
Sequence:CCGGGACAGGCTCTATGAATGCAAACTCGAGTTTGCATTCATAGAGCCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-1031s1c1
Sequence:CCGGCGAGGACAACTTACTCTGCATCTCGAGATGCAGAGTAAGTTGTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133466.2-1360s21c1
Sequence:GTACCGGTAGCCGTGGTTATCATCTTATCTCGAGATAAGATGATAACCACGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133466.2-2073s21c1
Sequence:CCGGCATACTGGACAAGACGCTTAACTCGAGTTAAGCGTCTTGTCCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133466.2-1698s21c1
Sequence:CCGGGACTTAATTCATCCCTTATTCCTCGAGGAATAAGGGATGAATTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133466.2-1519s21c1
Sequence:CCGGGAAGGCCTTCAGACTACTTTCCTCGAGGAAAGTAGTCTGAAGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133466.2-1128s21c1
Sequence:CCGGCTCGGCATCAGAAGCTTAATACTCGAGTATTAAGCTTCTGATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133466
ZFP82 MISSION shRNA Lentiviral Transduction Particles
ZFP82 zinc finger protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-1523s1c1
Sequence:CCGGGCCTTCAGACTACTTTCACAACTCGAGTTGTGAAAGTAGTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-695s1c1
Sequence:CCGGCGCACATCTGTTACTCCACATCTCGAGATGTGGAGTAACAGATGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-424s1c1
Sequence:CCGGGCCTTGGAAAGTTGTGAGGAACTCGAGTTCCTCACAACTTTCCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-1154s1c1
Sequence:CCGGGACAGGCTCTATGAATGCAAACTCGAGTTTGCATTCATAGAGCCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133466.1-1031s1c1
Sequence:CCGGCGAGGACAACTTACTCTGCATCTCGAGATGCAGAGTAAGTTGTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133466.2-1360s21c1
Sequence:GTACCGGTAGCCGTGGTTATCATCTTATCTCGAGATAAGATGATAACCACGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133466.2-2073s21c1
Sequence:CCGGCATACTGGACAAGACGCTTAACTCGAGTTAAGCGTCTTGTCCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133466.2-1698s21c1
Sequence:CCGGGACTTAATTCATCCCTTATTCCTCGAGGAATAAGGGATGAATTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133466.2-1519s21c1
Sequence:CCGGGAAGGCCTTCAGACTACTTTCCTCGAGGAAAGTAGTCTGAAGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133466.2-1128s21c1
Sequence:CCGGCTCGGCATCAGAAGCTTAATACTCGAGTATTAAGCTTCTGATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks