EMAIL THIS PAGE TO A FRIEND

ZFP90

ZFP90 zinc finger protein

Synonyms: FIK NK10 ZNF756
UniProtKB ID: Q8TF47, B2RU00, B3KVE7, Q49AD1, Q96MQ6
Gene ID:
Mouse(22751) zinc finger protein 90
Rat(498945) zinc finger protein 90
domestic guinea pig(101787717) ZFP90 zinc finger protein
naked mole-rat(101721326) ZFP90 zinc finger protein
cow(100139934) zinc finger protein 90 homolog (mouse)
sheep(101111386) zinc finger protein 90 homolog (mouse)
dog(100683215) zinc finger protein 90 homolog (mouse)
domestic cat(101094642) zinc finger protein 90 homolog (mouse)
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133458 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133458 Rosetta Predictions human pricing
NM_001025765 Rosetta Predictions rat pricing
NM_011764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363148 predicted 913
2 SASI_Hs01_00173518 predicted 1558
3 SASI_Hs01_00173519 predicted 1460
4 SASI_Hs02_00363149 predicted 1151
5 SASI_Hs02_00363150 predicted 299
6 SASI_Hs02_00363151 predicted 260
7 SASI_Hs02_00363152 predicted 1060
8 SASI_Hs02_00363153 predicted 962
9 SASI_Hs02_00363154 predicted 1086
10 SASI_Hs02_00363155 predicted 1334
11 SASI_Hs01_00173516 predicted 1612
12 SASI_Hs01_00173517 predicted 1563
13 SASI_Hs01_00173520 predicted 1555
14 SASI_Hs01_00173521 predicted 1568
15 SASI_Hs01_00173522 predicted 1624
16 SASI_Hs01_00173523 predicted 1605
17 SASI_Hs01_00173524 predicted 1645
18 SASI_Hs01_00173525 predicted 1571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113771 predicted 1387
2 SASI_Rn01_00113773 predicted 791
3 SASI_Rn01_00113774 predicted 1424
4 SASI_Rn01_00113775 predicted 1357
5 SASI_Rn01_00113776 predicted 777
6 SASI_Rn01_00113777 predicted 1439
7 SASI_Rn01_00113778 predicted 855
8 SASI_Rn01_00113779 predicted 929
9 SASI_Rn01_00113780 predicted 678
10 SASI_Rn02_00203441 predicted 263
11 SASI_Rn01_00113772 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172879 predicted 986
2 SASI_Mm02_00321378 predicted 2385
3 SASI_Mm01_00172880 predicted 985
4 SASI_Mm01_00172881 predicted 1643
5 SASI_Mm01_00172882 predicted 1051
6 SASI_Mm01_00172883 predicted 1500
7 SASI_Mm01_00172884 predicted 702
8 SASI_Mm01_00172885 predicted 860
9 SASI_Mm01_00172887 predicted 2163
10 SASI_Mm01_00172888 predicted 1034
11 SASI_Mm01_00172886 predicted 1648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011764
VALIDATED
ZFP90 MISSION shRNA Bacterial Glycerol Stock
ZFP90 zinc finger protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-2412s1c1
Sequence:CCGGGCCATTCTTTCATACCTTATTCTCGAGAATAAGGTATGAAAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-651s1c1
Sequence:CCGGGCAGGGCGTATCTGAAGTATTCTCGAGAATACTTCAGATACGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-1679s1c1
Sequence:CCGGCTGAAGTAAAGTCGTACCATTCTCGAGAATGGTACGACTTTACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-948s1c1
Sequence:CCGGTCAGAGTAATATCCTTGCTAACTCGAGTTAGCAAGGATATTACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-465s1c1
Sequence:CCGGGAGCTTATACAGGGATGTCATCTCGAGATGACATCCCTGTATAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-868s21c1
Sequence:CCGGGTTGGTGAAGACTCTAGTTTGCTCGAGCAAACTAGAGTCTTCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-1721s21c1
Sequence:CCGGCTGAAGTAAAGTCGTACCATTCTCGAGAATGGTACGACTTTACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-507s21c1
Sequence:CCGGGAGCTTATACAGGGATGTCATCTCGAGATGACATCCCTGTATAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-693s21c1
Sequence:CCGGGCAGGGCGTATCTGAAGTATTCTCGAGAATACTTCAGATACGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-2454s21c1
Sequence:CCGGGCCATTCTTTCATACCTTATTCTCGAGAATAAGGTATGAAAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011764
VALIDATED
ZFP90 MISSION shRNA shRNA Plasmid DNA
ZFP90 zinc finger protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-2412s1c1
Sequence:CCGGGCCATTCTTTCATACCTTATTCTCGAGAATAAGGTATGAAAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-651s1c1
Sequence:CCGGGCAGGGCGTATCTGAAGTATTCTCGAGAATACTTCAGATACGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-1679s1c1
Sequence:CCGGCTGAAGTAAAGTCGTACCATTCTCGAGAATGGTACGACTTTACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-948s1c1
Sequence:CCGGTCAGAGTAATATCCTTGCTAACTCGAGTTAGCAAGGATATTACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-465s1c1
Sequence:CCGGGAGCTTATACAGGGATGTCATCTCGAGATGACATCCCTGTATAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-868s21c1
Sequence:CCGGGTTGGTGAAGACTCTAGTTTGCTCGAGCAAACTAGAGTCTTCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-1721s21c1
Sequence:CCGGCTGAAGTAAAGTCGTACCATTCTCGAGAATGGTACGACTTTACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-507s21c1
Sequence:CCGGGAGCTTATACAGGGATGTCATCTCGAGATGACATCCCTGTATAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-693s21c1
Sequence:CCGGGCAGGGCGTATCTGAAGTATTCTCGAGAATACTTCAGATACGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-2454s21c1
Sequence:CCGGGCCATTCTTTCATACCTTATTCTCGAGAATAAGGTATGAAAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011764
VALIDATED
ZFP90 MISSION shRNA Lentiviral Transduction Particles
ZFP90 zinc finger protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-2412s1c1
Sequence:CCGGGCCATTCTTTCATACCTTATTCTCGAGAATAAGGTATGAAAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-651s1c1
Sequence:CCGGGCAGGGCGTATCTGAAGTATTCTCGAGAATACTTCAGATACGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-1679s1c1
Sequence:CCGGCTGAAGTAAAGTCGTACCATTCTCGAGAATGGTACGACTTTACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-948s1c1
Sequence:CCGGTCAGAGTAATATCCTTGCTAACTCGAGTTAGCAAGGATATTACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011764.2-465s1c1
Sequence:CCGGGAGCTTATACAGGGATGTCATCTCGAGATGACATCCCTGTATAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-868s21c1
Sequence:CCGGGTTGGTGAAGACTCTAGTTTGCTCGAGCAAACTAGAGTCTTCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-1721s21c1
Sequence:CCGGCTGAAGTAAAGTCGTACCATTCTCGAGAATGGTACGACTTTACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-507s21c1
Sequence:CCGGGAGCTTATACAGGGATGTCATCTCGAGATGACATCCCTGTATAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-693s21c1
Sequence:CCGGGCAGGGCGTATCTGAAGTATTCTCGAGAATACTTCAGATACGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011764.3-2454s21c1
Sequence:CCGGGCCATTCTTTCATACCTTATTCTCGAGAATAAGGTATGAAAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133458
ZFP90 MISSION shRNA Bacterial Glycerol Stock
ZFP90 zinc finger protein
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133458.1-2083s1c1
Sequence:CCGGCCAACCTGCATGATCATCAGACTCGAGTCTGATGATCATGCAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133458.2-699s21c1
Sequence:GTACCGGCATAGATCATCGCTTACTAAACTCGAGTTTAGTAAGCGATGATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133458.2-1940s21c1
Sequence:GTACCGGACTCTAGGAACCGTGAAATTACTCGAGTAATTTCACGGTTCCTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133458.2-3944s21c1
Sequence:CCGGATAGTTTGACAATGGGTAATTCTCGAGAATTACCCATTGTCAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133458.2-1308s21c1
Sequence:CCGGAGTAACTACAGCATAGATTTCCTCGAGGAAATCTATGCTGTAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133458.2-614s21c1
Sequence:CCGGACATAATGCAGACTTACTTAACTCGAGTTAAGTAAGTCTGCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133458
ZFP90 MISSION shRNA shRNA Plasmid DNA
ZFP90 zinc finger protein
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133458.1-2083s1c1
Sequence:CCGGCCAACCTGCATGATCATCAGACTCGAGTCTGATGATCATGCAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133458.2-699s21c1
Sequence:GTACCGGCATAGATCATCGCTTACTAAACTCGAGTTTAGTAAGCGATGATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133458.2-1940s21c1
Sequence:GTACCGGACTCTAGGAACCGTGAAATTACTCGAGTAATTTCACGGTTCCTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133458.2-3944s21c1
Sequence:CCGGATAGTTTGACAATGGGTAATTCTCGAGAATTACCCATTGTCAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133458.2-1308s21c1
Sequence:CCGGAGTAACTACAGCATAGATTTCCTCGAGGAAATCTATGCTGTAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133458.2-614s21c1
Sequence:CCGGACATAATGCAGACTTACTTAACTCGAGTTAAGTAAGTCTGCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133458
ZFP90 MISSION shRNA Lentiviral Transduction Particles
ZFP90 zinc finger protein
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133458.1-2083s1c1
Sequence:CCGGCCAACCTGCATGATCATCAGACTCGAGTCTGATGATCATGCAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133458.2-699s21c1
Sequence:GTACCGGCATAGATCATCGCTTACTAAACTCGAGTTTAGTAAGCGATGATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133458.2-1940s21c1
Sequence:GTACCGGACTCTAGGAACCGTGAAATTACTCGAGTAATTTCACGGTTCCTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133458.2-3944s21c1
Sequence:CCGGATAGTTTGACAATGGGTAATTCTCGAGAATTACCCATTGTCAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133458.2-1308s21c1
Sequence:CCGGAGTAACTACAGCATAGATTTCCTCGAGGAAATCTATGCTGTAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133458.2-614s21c1
Sequence:CCGGACATAATGCAGACTTACTTAACTCGAGTTAAGTAAGTCTGCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks