EMAIL THIS PAGE TO A FRIEND

ZFP91

ZFP91 zinc finger protein

Synonyms: DMS-8 DSM-8 PZF ZFP-91 ZNF757
UniProtKB ID: Q96JP5, A6NHC4, A8MSG7, Q86V47, Q96JP4, Q96QA3
Gene ID:
Human(80829) Summary: The protein encoded by this gene is a member of the zinc finger family of proteins. The gene product contains C2H2-type domains, which are the classical zinc finger domains found in numerous nucleic acid-binding proteins. This protein functions as a regulator of the non-canonical NF-kappaB pathway in lymphotoxin-beta receptor signaling. Alternative splicing results in multiple transcript variants. A read-through transcript variant composed of ZFP91 and the downstream CNTF gene sequence has been identified, but it is thought to be non-coding. Read-through transcription of ZFP91 and CNTF has also been observed in mouse. A ZFP91-related pseudogene has also been identified on chromosome 2. [provided by RefSeq, Oct 2010]
Mouse(109910) zinc finger protein 91
Rat(246282) zinc finger protein 91
chicken(423128) zinc finger protein 91 homolog (mouse)
Horse(100068291) zinc finger protein 91 homolog (mouse)
domestic cat(101094206) zinc finger protein 91 homolog (mouse)
dog(475962) zinc finger protein 91 homolog (mouse)
cow(529006) ZFP91 zinc finger protein
naked mole-rat(101714742) ZFP91 zinc finger protein
domestic guinea pig(100725175) ZFP91 zinc finger protein
283 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301688 Anti-ZFP91 affinity isolated antibody human
immunohistochemistry pricing
AV36119 Anti-ZFP91 (AB1) antibody produced in rabbit affinity isolated antibody canine, mouse, horse, human, rabbit, guinea pig
western blot pricing
AV36120 Anti-ZFP91 (AB2) antibody produced in rabbit IgG fraction of antiserum rabbit, sheep, canine, human, mouse, horse, rat, guinea pig
western blot pricing
HPA065325 Anti-ZFP91 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053023 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053009 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053009 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053009 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053023 Rosetta Predictions human pricing
XM_001078426 Rosetta Predictions rat pricing
XM_001079228 Rosetta Predictions rat pricing
NM_053009 Rosetta Predictions mouse pricing
XM_988843 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231261 predicted 626
2 SASI_Hs01_00231262 predicted 692
3 SASI_Hs01_00231263 predicted 1356
4 SASI_Hs01_00231264 predicted 579
5 SASI_Hs01_00231266 predicted 688
6 SASI_Hs01_00231267 predicted 678
7 SASI_Hs01_00231268 predicted 635
8 SASI_Hs01_00231269 predicted 663
9 SASI_Hs01_00231270 predicted 1309
10 SASI_Hs02_00361843 predicted 1428
11 SASI_Hs01_00231265 predicted 1211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360744 predicted 1362
2 SASI_Rn02_00360745 predicted 2212
3 SASI_Rn02_00360746 predicted 1291
4 SASI_Rn02_00360747 predicted 1429
5 SASI_Rn02_00360748 predicted 1413
6 SASI_Rn02_00360749 predicted 2162
7 SASI_Rn02_00360750 predicted 501
8 SASI_Rn02_00360751 predicted 1429
9 SASI_Rn02_00360752 predicted 1469
10 SASI_Rn02_00360753 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363583 predicted 1361
2 SASI_Rn02_00363584 predicted 2209
3 SASI_Rn02_00363585 predicted 1300
4 SASI_Rn02_00363586 predicted 1434
5 SASI_Rn02_00363587 predicted 1409
6 SASI_Rn02_00363588 predicted 2168
7 SASI_Rn02_00363589 predicted 500
8 SASI_Rn02_00363590 predicted 1426
9 SASI_Rn02_00363591 predicted 1475
10 SASI_Rn02_00363592 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198604 predicted 1296
2 SASI_Mm01_00198605 predicted 1262
3 SASI_Mm01_00198606 predicted 1229
4 SASI_Mm01_00198607 predicted 1269
5 SASI_Mm01_00198608 predicted 1307
6 SASI_Mm01_00198609 predicted 1267
7 SASI_Mm01_00198610 predicted 1234
8 SASI_Mm01_00198611 predicted 1275
9 SASI_Mm01_00198612 predicted 1262
10 SASI_Mm02_00337513 predicted 2055
11 SASI_Mm01_00198603 predicted 2089
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229814 predicted 1364
2 SASI_Mm01_00229815 predicted 543
3 SASI_Mm01_00229816 predicted 639
4 SASI_Mm01_00229817 predicted 490
5 SASI_Mm01_00229818 predicted 1182
6 SASI_Mm01_00229819 predicted 543
7 SASI_Mm01_00229820 predicted 1137
8 SASI_Mm01_00229821 predicted 1131
9 SASI_Mm01_00229822 predicted 738
10 SASI_Mm01_00229823 predicted 1270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053023
VALIDATED
ZFP91 MISSION shRNA Bacterial Glycerol Stock
ZFP91 zinc finger protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-2129s21c1
Sequence:CCGGGCTCTTAAAGTGAGGGTTATTCTCGAGAATAACCCTCACTTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-1438s21c1
Sequence:CCGGGCAGACTCCTTCTACCAGTTTCTCGAGAAACTGGTAGAAGGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-1144s21c1
Sequence:CCGGCGCTATTTGCAGCACCACATTCTCGAGAATGTGGTGCTGCAAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-1808s21c1
Sequence:CCGGTGGTTATGAACTCAGATATACCTCGAGGTATATCTGAGTTCATAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-500s21c1
Sequence:CCGGCGCGACTCCTATGCATAGAAACTCGAGTTTCTATGCATAGGAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_053023.2-1194s1c1
Sequence:CCGGCCAAACATCATACAGATCAAACTCGAGTTTGATCTGTATGATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_053023.2-1082s1c1
Sequence:CCGGCGCTATTTGCAGCACCACATTCTCGAGAATGTGGTGCTGCAAATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_053023.2-438s1c1
Sequence:CCGGCGCGACTCCTATGCATAGAAACTCGAGTTTCTATGCATAGGAGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_053023.2-1376s1c1
Sequence:CCGGGCAGACTCCTTCTACCAGTTTCTCGAGAAACTGGTAGAAGGAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053023
VALIDATED
ZFP91 MISSION shRNA shRNA Plasmid DNA
ZFP91 zinc finger protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-2129s21c1
Sequence:CCGGGCTCTTAAAGTGAGGGTTATTCTCGAGAATAACCCTCACTTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-1438s21c1
Sequence:CCGGGCAGACTCCTTCTACCAGTTTCTCGAGAAACTGGTAGAAGGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-1144s21c1
Sequence:CCGGCGCTATTTGCAGCACCACATTCTCGAGAATGTGGTGCTGCAAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-1808s21c1
Sequence:CCGGTGGTTATGAACTCAGATATACCTCGAGGTATATCTGAGTTCATAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-500s21c1
Sequence:CCGGCGCGACTCCTATGCATAGAAACTCGAGTTTCTATGCATAGGAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_053023.2-1194s1c1
Sequence:CCGGCCAAACATCATACAGATCAAACTCGAGTTTGATCTGTATGATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_053023.2-1082s1c1
Sequence:CCGGCGCTATTTGCAGCACCACATTCTCGAGAATGTGGTGCTGCAAATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_053023.2-438s1c1
Sequence:CCGGCGCGACTCCTATGCATAGAAACTCGAGTTTCTATGCATAGGAGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_053023.2-1376s1c1
Sequence:CCGGGCAGACTCCTTCTACCAGTTTCTCGAGAAACTGGTAGAAGGAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053023
VALIDATED
ZFP91 MISSION shRNA Lentiviral Transduction Particles
ZFP91 zinc finger protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-2129s21c1
Sequence:CCGGGCTCTTAAAGTGAGGGTTATTCTCGAGAATAACCCTCACTTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-1438s21c1
Sequence:CCGGGCAGACTCCTTCTACCAGTTTCTCGAGAAACTGGTAGAAGGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-1144s21c1
Sequence:CCGGCGCTATTTGCAGCACCACATTCTCGAGAATGTGGTGCTGCAAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-1808s21c1
Sequence:CCGGTGGTTATGAACTCAGATATACCTCGAGGTATATCTGAGTTCATAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_053023.3-500s21c1
Sequence:CCGGCGCGACTCCTATGCATAGAAACTCGAGTTTCTATGCATAGGAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_053023.2-1194s1c1
Sequence:CCGGCCAAACATCATACAGATCAAACTCGAGTTTGATCTGTATGATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_053023.2-1082s1c1
Sequence:CCGGCGCTATTTGCAGCACCACATTCTCGAGAATGTGGTGCTGCAAATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_053023.2-438s1c1
Sequence:CCGGCGCGACTCCTATGCATAGAAACTCGAGTTTCTATGCATAGGAGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_053023.2-1376s1c1
Sequence:CCGGGCAGACTCCTTCTACCAGTTTCTCGAGAAACTGGTAGAAGGAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053009
VALIDATED
ZFP91 MISSION shRNA Bacterial Glycerol Stock
ZFP91 zinc finger protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053009.2-2434s21c1
Sequence:CCGGCTGGTCATGAACTCGGATATACTCGAGTATATCCGAGTTCATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053009.2-4876s21c1
Sequence:GTACCGGGAGAGCTAGTGCTAGTATAATCTCGAGATTATACTAGCACTAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053009.2-2495s21c1
Sequence:CCGGCTACTGGACCCTAGTGCAAAGCTCGAGCTTTGCACTAGGGTCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053009.2-2381s21c1
Sequence:CCGGTGGCTGACGGGAAGATCTTTGCTCGAGCAAAGATCTTCCCGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053009.2-2462s21c1
Sequence:CCGGCTACCACAGAGGTTCTGATTGCTCGAGCAATCAGAACCTCTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053009
VALIDATED
ZFP91 MISSION shRNA shRNA Plasmid DNA
ZFP91 zinc finger protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053009.2-2434s21c1
Sequence:CCGGCTGGTCATGAACTCGGATATACTCGAGTATATCCGAGTTCATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053009.2-4876s21c1
Sequence:GTACCGGGAGAGCTAGTGCTAGTATAATCTCGAGATTATACTAGCACTAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053009.2-2495s21c1
Sequence:CCGGCTACTGGACCCTAGTGCAAAGCTCGAGCTTTGCACTAGGGTCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053009.2-2381s21c1
Sequence:CCGGTGGCTGACGGGAAGATCTTTGCTCGAGCAAAGATCTTCCCGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053009.2-2462s21c1
Sequence:CCGGCTACCACAGAGGTTCTGATTGCTCGAGCAATCAGAACCTCTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053009
VALIDATED
ZFP91 MISSION shRNA Lentiviral Transduction Particles
ZFP91 zinc finger protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053009.2-2434s21c1
Sequence:CCGGCTGGTCATGAACTCGGATATACTCGAGTATATCCGAGTTCATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053009.2-4876s21c1
Sequence:GTACCGGGAGAGCTAGTGCTAGTATAATCTCGAGATTATACTAGCACTAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053009.2-2495s21c1
Sequence:CCGGCTACTGGACCCTAGTGCAAAGCTCGAGCTTTGCACTAGGGTCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053009.2-2381s21c1
Sequence:CCGGTGGCTGACGGGAAGATCTTTGCTCGAGCAAAGATCTTCCCGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053009.2-2462s21c1
Sequence:CCGGCTACCACAGAGGTTCTGATTGCTCGAGCAATCAGAACCTCTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks