EMAIL THIS PAGE TO A FRIEND

ZFP92

ZFP92 zinc finger protein

Synonyms: ZNF897
UniProtKB ID: A6NM28
Gene ID:
Mouse(22754) zinc finger protein 92
Rat(100359785) zinc finger protein 92
cow(101908003) ZFP92 zinc finger protein
sheep(101102626) zinc finger protein 92 homolog (mouse)
domestic guinea pig(100714531) ZFP92 zinc finger protein
naked mole-rat(101714415) ZFP92 zinc finger protein
chicken(418448) zinc finger protein 92 homolog (mouse)
dog(100687583) zinc finger protein 92 homolog (mouse)
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001136273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136273 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001714564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001714564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001714564 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714564 Rosetta Predictions human pricing
XM_001714585 Rosetta Predictions human pricing
XM_066859 Rosetta Predictions human pricing
NM_009566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00397959 predicted 1022
2 SASI_Hs02_00397960 predicted 1034
3 SASI_Hs02_00397961 predicted 915
4 SASI_Hs02_00397962 predicted 875
5 SASI_Hs02_00397963 predicted 1012
6 SASI_Hs02_00397964 predicted 1005
7 SASI_Hs02_00397965 predicted 1461
8 SASI_Hs02_00397966 predicted 985
9 SASI_Hs02_00397967 predicted 823
10 SASI_Hs02_00397968 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398102 predicted 1622
2 SASI_Hs02_00398103 predicted 1631
3 SASI_Hs02_00398104 predicted 1517
4 SASI_Hs02_00398105 predicted 1482
5 SASI_Hs02_00398106 predicted 1613
6 SASI_Hs02_00398107 predicted 490
7 SASI_Hs02_00398108 predicted 1599
8 SASI_Hs02_00398109 predicted 2060
9 SASI_Hs02_00398110 predicted 1586
10 SASI_Hs02_00398111 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_066859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478772 predicted 586
2 SASI_Hs02_00478773 predicted 632
3 SASI_Hs02_00478774 predicted 656
4 SASI_Hs02_00478775 predicted 580
5 SASI_Hs02_00478776 predicted 501
6 SASI_Hs02_00478777 predicted 584
7 SASI_Hs02_00478778 predicted 487
8 SASI_Hs02_00478779 predicted 580
9 SASI_Hs02_00478780 predicted 646
10 SASI_Hs02_00478781 predicted 442
11 SASI_Hs01_00249291 predicted 358
12 SASI_Hs01_00249292 predicted 340
13 SASI_Hs01_00249293 predicted 350
14 SASI_Hs01_00249294 predicted 240
15 SASI_Hs01_00249295 predicted 335
16 SASI_Hs01_00249296 predicted 325
17 SASI_Hs01_00249297 predicted 777
18 SASI_Hs01_00249298 predicted 303
19 SASI_Hs01_00249299 predicted 313
20 SASI_Hs01_00249300 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198743 predicted 578
2 SASI_Mm01_00198744 predicted 425
3 SASI_Mm01_00198745 predicted 1514
4 SASI_Mm01_00198746 predicted 634
5 SASI_Mm01_00198747 predicted 215
6 SASI_Mm01_00198748 predicted 376
7 SASI_Mm01_00198749 predicted 563
8 SASI_Mm01_00198750 predicted 586
9 SASI_Mm01_00198751 predicted 1470
10 SASI_Mm01_00198752 predicted 535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009566
ZFP92 MISSION shRNA Bacterial Glycerol Stock
ZFP92 zinc finger protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009566.1-2030s1c1
Sequence:CCGGCCATGAAGTTTACAGACAGATCTCGAGATCTGTCTGTAAACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009566.1-541s1c1
Sequence:CCGGTCCTCACGATTTCAGGCCAAACTCGAGTTTGGCCTGAAATCGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009566.1-292s1c1
Sequence:CCGGGACCCTCTACAAGCAAGTGATCTCGAGATCACTTGCTTGTAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009566.1-1486s1c1
Sequence:CCGGCGAAGATGACAAGAAACAGAACTCGAGTTCTGTTTCTTGTCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009566.1-542s1c1
Sequence:CCGGCCTCACGATTTCAGGCCAAATCTCGAGATTTGGCCTGAAATCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009566
ZFP92 MISSION shRNA shRNA Plasmid DNA
ZFP92 zinc finger protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009566.1-2030s1c1
Sequence:CCGGCCATGAAGTTTACAGACAGATCTCGAGATCTGTCTGTAAACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009566.1-541s1c1
Sequence:CCGGTCCTCACGATTTCAGGCCAAACTCGAGTTTGGCCTGAAATCGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009566.1-292s1c1
Sequence:CCGGGACCCTCTACAAGCAAGTGATCTCGAGATCACTTGCTTGTAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009566.1-1486s1c1
Sequence:CCGGCGAAGATGACAAGAAACAGAACTCGAGTTCTGTTTCTTGTCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009566.1-542s1c1
Sequence:CCGGCCTCACGATTTCAGGCCAAATCTCGAGATTTGGCCTGAAATCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009566
ZFP92 MISSION shRNA Lentiviral Transduction Particles
ZFP92 zinc finger protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009566.1-2030s1c1
Sequence:CCGGCCATGAAGTTTACAGACAGATCTCGAGATCTGTCTGTAAACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009566.1-541s1c1
Sequence:CCGGTCCTCACGATTTCAGGCCAAACTCGAGTTTGGCCTGAAATCGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009566.1-292s1c1
Sequence:CCGGGACCCTCTACAAGCAAGTGATCTCGAGATCACTTGCTTGTAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009566.1-1486s1c1
Sequence:CCGGCGAAGATGACAAGAAACAGAACTCGAGTTCTGTTTCTTGTCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009566.1-542s1c1
Sequence:CCGGCCTCACGATTTCAGGCCAAATCTCGAGATTTGGCCTGAAATCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136273
ZFP92 MISSION shRNA Bacterial Glycerol Stock
ZFP92 zinc finger protein
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000377593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136273.1-86s21c1
Sequence:CCGGAGCTTCTGGACCTCAGACAAACTCGAGTTTGTCTGAGGTCCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136273.1-26s21c1
Sequence:CCGGGACCCAAGGTGCCAGTATCTTCTCGAGAAGATACTGGCACCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136273.1-285s21c1
Sequence:CCGGGACGTCGACTTCAACGCAGAACTCGAGTTCTGCGTTGAAGTCGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136273.1-252s21c1
Sequence:CCGGAGGATTGCACATAGGTGACAGCTCGAGCTGTCACCTATGTGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136273
ZFP92 MISSION shRNA shRNA Plasmid DNA
ZFP92 zinc finger protein
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000377593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136273.1-86s21c1
Sequence:CCGGAGCTTCTGGACCTCAGACAAACTCGAGTTTGTCTGAGGTCCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136273.1-26s21c1
Sequence:CCGGGACCCAAGGTGCCAGTATCTTCTCGAGAAGATACTGGCACCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136273.1-285s21c1
Sequence:CCGGGACGTCGACTTCAACGCAGAACTCGAGTTCTGCGTTGAAGTCGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136273.1-252s21c1
Sequence:CCGGAGGATTGCACATAGGTGACAGCTCGAGCTGTCACCTATGTGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136273
ZFP92 MISSION shRNA Lentiviral Transduction Particles
ZFP92 zinc finger protein
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000377593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136273.1-86s21c1
Sequence:CCGGAGCTTCTGGACCTCAGACAAACTCGAGTTTGTCTGAGGTCCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136273.1-26s21c1
Sequence:CCGGGACCCAAGGTGCCAGTATCTTCTCGAGAAGATACTGGCACCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136273.1-285s21c1
Sequence:CCGGGACGTCGACTTCAACGCAGAACTCGAGTTCTGCGTTGAAGTCGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136273.1-252s21c1
Sequence:CCGGAGGATTGCACATAGGTGACAGCTCGAGCTGTCACCTATGTGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001714564
ZFP92 MISSION shRNA Bacterial Glycerol Stock
ZFP92 zinc finger protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-886s21c1
Sequence:CCGGCATTTGGTGTCACTGGGATTTCTCGAGAAATCCCAGTGACACCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-682s21c1
Sequence:CCGGCAGCACCACGAATGCCAAATGCTCGAGCATTTGGCATTCGTGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-919s21c1
Sequence:CCGGCCTCACCTGATCTCCCAATTGCTCGAGCAATTGGGAGATCAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-660s21c1
Sequence:CCGGTCTGCGCCTGTTCCCTAATTTCTCGAGAAATTAGGGAACAGGCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-796s21c1
Sequence:CCGGGTGTCCGTGTACTTCACAAAGCTCGAGCTTTGTGAAGTACACGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001714564
ZFP92 MISSION shRNA shRNA Plasmid DNA
ZFP92 zinc finger protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-886s21c1
Sequence:CCGGCATTTGGTGTCACTGGGATTTCTCGAGAAATCCCAGTGACACCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-682s21c1
Sequence:CCGGCAGCACCACGAATGCCAAATGCTCGAGCATTTGGCATTCGTGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-919s21c1
Sequence:CCGGCCTCACCTGATCTCCCAATTGCTCGAGCAATTGGGAGATCAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-660s21c1
Sequence:CCGGTCTGCGCCTGTTCCCTAATTTCTCGAGAAATTAGGGAACAGGCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-796s21c1
Sequence:CCGGGTGTCCGTGTACTTCACAAAGCTCGAGCTTTGTGAAGTACACGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001714564
ZFP92 MISSION shRNA Lentiviral Transduction Particles
ZFP92 zinc finger protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-886s21c1
Sequence:CCGGCATTTGGTGTCACTGGGATTTCTCGAGAAATCCCAGTGACACCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-682s21c1
Sequence:CCGGCAGCACCACGAATGCCAAATGCTCGAGCATTTGGCATTCGTGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-919s21c1
Sequence:CCGGCCTCACCTGATCTCCCAATTGCTCGAGCAATTGGGAGATCAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-660s21c1
Sequence:CCGGTCTGCGCCTGTTCCCTAATTTCTCGAGAAATTAGGGAACAGGCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714564.1-796s21c1
Sequence:CCGGGTGTCCGTGTACTTCACAAAGCTCGAGCTTTGTGAAGTACACGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks