EMAIL THIS PAGE TO A FRIEND

ZFPL1

zinc finger protein-like 1

Synonyms: D11S750 MCG4
UniProtKB ID: O95159, A8K7E9, O14616, Q9UID0
Gene ID:
Mouse(81909) zinc finger like protein 1
Rat(684755) zinc finger protein-like 1
Rat(84602) zinc finger like protein 1
domestic guinea pig(100725192) zinc finger protein-like 1
naked mole-rat(101701020) zinc finger protein-like 1
cow(613442) zinc finger protein-like 1
Goat(100861119) zinc finger protein-like 1
sheep(101120454) zinc finger protein-like 1
Zebrafish(393646) zinc finger protein-like 1
domestic cat(101083294) zinc finger protein-like 1
dog(483750) zinc finger protein-like 1
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA014909 Anti-ZFPL1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA017347 Anti-ZFPL1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV34354 Anti-ZFPL1 antibody produced in rabbit affinity isolated antibody horse, guinea pig, rabbit, canine, bovine, human, mouse, rat
immunohistochemistry, western blot pricing
SAB2102772 Anti-ZFPL1 antibody produced in rabbit affinity isolated antibody human, guinea pig, bovine, rabbit, rat, zebrafish, canine, horse, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024231 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024231 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024231 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006782 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006782 Rosetta Predictions human pricing
XM_001075242 Rosetta Predictions rat pricing
XM_001075265 Rosetta Predictions rat pricing
XM_001075288 Rosetta Predictions rat pricing
NM_024231 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160504 predicted 217
2 SASI_Hs01_00160505 predicted 752
3 SASI_Hs01_00160506 predicted 1123
4 SASI_Hs02_00342296 predicted 217
5 SASI_Hs02_00342297 predicted 599
6 SASI_Hs01_00160507 predicted 517
7 SASI_Hs01_00160509 predicted 242
8 SASI_Hs01_00160510 predicted 803
9 SASI_Hs01_00160511 predicted 823
10 SASI_Hs01_00160512 predicted 196
11 SASI_Hs01_00160503 predicted 624
12 SASI_Hs01_00160508 predicted 196
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348932 predicted 623
2 SASI_Rn02_00348933 predicted 201
3 SASI_Rn02_00348934 predicted 217
4 SASI_Rn02_00348935 predicted 1072
5 SASI_Rn02_00348936 predicted 650
6 SASI_Rn02_00348937 predicted 607
7 SASI_Rn02_00348938 predicted 206
8 SASI_Rn02_00348939 predicted 366
9 SASI_Rn02_00348940 predicted 1136
10 SASI_Rn02_00348941 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349031 predicted 548
2 SASI_Rn02_00349032 predicted 680
3 SASI_Rn02_00349033 predicted 576
4 SASI_Rn02_00349034 predicted 768
5 SASI_Rn02_00349035 predicted 526
6 SASI_Rn02_00349036 predicted 492
7 SASI_Rn02_00349037 predicted 663
8 SASI_Rn02_00349038 predicted 766
9 SASI_Rn02_00349039 predicted 220
10 SASI_Rn02_00349040 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349155 predicted 640
2 SASI_Rn02_00349156 predicted 219
3 SASI_Rn02_00349157 predicted 243
4 SASI_Rn02_00349158 predicted 1095
5 SASI_Rn02_00349159 predicted 664
6 SASI_Rn02_00349160 predicted 618
7 SASI_Rn02_00349161 predicted 221
8 SASI_Rn02_00349162 predicted 383
9 SASI_Rn02_00349163 predicted 1154
10 SASI_Rn02_00349164 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199461 predicted 708
2 SASI_Mm01_00199462 predicted 491
3 SASI_Mm01_00199463 predicted 232
4 SASI_Mm01_00199464 predicted 217
5 SASI_Mm01_00199465 predicted 551
6 SASI_Mm01_00199466 predicted 226
7 SASI_Mm01_00199467 predicted 473
8 SASI_Mm01_00199468 predicted 437
9 SASI_Mm01_00199469 predicted 640
10 SASI_Mm01_00199470 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024231
VALIDATED
ZFPL1 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024231.1-165s1c1
Sequence:CCGGGCTACAAGATAGTGACTACAACTCGAGTTGTAGTCACTATCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024231.1-618s1c1
Sequence:CCGGGCAGCACACAGTCATACACATCTCGAGATGTGTATGACTGTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024231.1-676s1c1
Sequence:CCGGGTATATGACACACGGGATGATCTCGAGATCATCCCGTGTGTCATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024231.1-265s1c1
Sequence:CCGGGCCTGTATCAATGAACGTGCTCTCGAGAGCACGTTCATTGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024231.1-439s1c1
Sequence:CCGGCCTCTGATCGATGAGGTGATACTCGAGTATCACCTCATCGATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-165s21c1
Sequence:CCGGGCTACAAGATAGTGACTACAACTCGAGTTGTAGTCACTATCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-676s21c1
Sequence:CCGGGTATATGACACACGGGATGATCTCGAGATCATCCCGTGTGTCATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-441s21c1
Sequence:CCGGTCTGATCGATGAGGTGATAAGCTCGAGCTTATCACCTCATCGATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-1056s21c1
Sequence:CCGGCCTCAGTCCTGAGACACTAAGCTCGAGCTTAGTGTCTCAGGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-81s21c1
Sequence:CCGGCTGCTTCGAACACCGAGTTAACTCGAGTTAACTCGGTGTTCGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024231
VALIDATED
ZFPL1 MISSION shRNA shRNA Plasmid DNA
zinc finger protein-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024231.1-165s1c1
Sequence:CCGGGCTACAAGATAGTGACTACAACTCGAGTTGTAGTCACTATCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024231.1-618s1c1
Sequence:CCGGGCAGCACACAGTCATACACATCTCGAGATGTGTATGACTGTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024231.1-676s1c1
Sequence:CCGGGTATATGACACACGGGATGATCTCGAGATCATCCCGTGTGTCATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024231.1-265s1c1
Sequence:CCGGGCCTGTATCAATGAACGTGCTCTCGAGAGCACGTTCATTGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024231.1-439s1c1
Sequence:CCGGCCTCTGATCGATGAGGTGATACTCGAGTATCACCTCATCGATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-165s21c1
Sequence:CCGGGCTACAAGATAGTGACTACAACTCGAGTTGTAGTCACTATCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-676s21c1
Sequence:CCGGGTATATGACACACGGGATGATCTCGAGATCATCCCGTGTGTCATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-441s21c1
Sequence:CCGGTCTGATCGATGAGGTGATAAGCTCGAGCTTATCACCTCATCGATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-1056s21c1
Sequence:CCGGCCTCAGTCCTGAGACACTAAGCTCGAGCTTAGTGTCTCAGGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-81s21c1
Sequence:CCGGCTGCTTCGAACACCGAGTTAACTCGAGTTAACTCGGTGTTCGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024231
VALIDATED
ZFPL1 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024231.1-165s1c1
Sequence:CCGGGCTACAAGATAGTGACTACAACTCGAGTTGTAGTCACTATCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024231.1-618s1c1
Sequence:CCGGGCAGCACACAGTCATACACATCTCGAGATGTGTATGACTGTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024231.1-676s1c1
Sequence:CCGGGTATATGACACACGGGATGATCTCGAGATCATCCCGTGTGTCATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024231.1-265s1c1
Sequence:CCGGGCCTGTATCAATGAACGTGCTCTCGAGAGCACGTTCATTGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024231.1-439s1c1
Sequence:CCGGCCTCTGATCGATGAGGTGATACTCGAGTATCACCTCATCGATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-165s21c1
Sequence:CCGGGCTACAAGATAGTGACTACAACTCGAGTTGTAGTCACTATCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-676s21c1
Sequence:CCGGGTATATGACACACGGGATGATCTCGAGATCATCCCGTGTGTCATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-441s21c1
Sequence:CCGGTCTGATCGATGAGGTGATAAGCTCGAGCTTATCACCTCATCGATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-1056s21c1
Sequence:CCGGCCTCAGTCCTGAGACACTAAGCTCGAGCTTAGTGTCTCAGGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024231.2-81s21c1
Sequence:CCGGCTGCTTCGAACACCGAGTTAACTCGAGTTAACTCGGTGTTCGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006782
VALIDATED
ZFPL1 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-281s1c1
Sequence:CCGGGCTCCAAGATAGCGACTACAACTCGAGTTGTAGTCGCTATCTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-792s1c1
Sequence:CCGGGTGTATGATACGCGGGATGATCTCGAGATCATCCCGCGTATCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-604s1c1
Sequence:CCGGCTGACTTCTCTGACTGGTCTACTCGAGTAGACCAGTCAGAGAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-353s1c1
Sequence:CCGGCCTTGTCTGCTATGATCTCTTCTCGAGAAGAGATCATAGCAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-1046s1c1
Sequence:CCGGCCCACTCATGAACCCTCACATCTCGAGATGTGAGGGTTCATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006782.3-805s21c1
Sequence:CCGGGTGTATGATACGCGGGATGATCTCGAGATCATCCCGCGTATCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006782.3-366s21c1
Sequence:CCGGCCTTGTCTGCTATGATCTCTTCTCGAGAAGAGATCATAGCAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006782.3-617s21c1
Sequence:CCGGCTGACTTCTCTGACTGGTCTACTCGAGTAGACCAGTCAGAGAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006782.3-294s21c1
Sequence:CCGGGCTCCAAGATAGCGACTACAACTCGAGTTGTAGTCGCTATCTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006782.3-1059s21c1
Sequence:CCGGCCCACTCATGAACCCTCACATCTCGAGATGTGAGGGTTCATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006782
VALIDATED
ZFPL1 MISSION shRNA shRNA Plasmid DNA
zinc finger protein-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-281s1c1
Sequence:CCGGGCTCCAAGATAGCGACTACAACTCGAGTTGTAGTCGCTATCTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-792s1c1
Sequence:CCGGGTGTATGATACGCGGGATGATCTCGAGATCATCCCGCGTATCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-604s1c1
Sequence:CCGGCTGACTTCTCTGACTGGTCTACTCGAGTAGACCAGTCAGAGAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-353s1c1
Sequence:CCGGCCTTGTCTGCTATGATCTCTTCTCGAGAAGAGATCATAGCAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-1046s1c1
Sequence:CCGGCCCACTCATGAACCCTCACATCTCGAGATGTGAGGGTTCATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006782.3-805s21c1
Sequence:CCGGGTGTATGATACGCGGGATGATCTCGAGATCATCCCGCGTATCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006782.3-366s21c1
Sequence:CCGGCCTTGTCTGCTATGATCTCTTCTCGAGAAGAGATCATAGCAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006782.3-617s21c1
Sequence:CCGGCTGACTTCTCTGACTGGTCTACTCGAGTAGACCAGTCAGAGAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006782.3-294s21c1
Sequence:CCGGGCTCCAAGATAGCGACTACAACTCGAGTTGTAGTCGCTATCTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006782.3-1059s21c1
Sequence:CCGGCCCACTCATGAACCCTCACATCTCGAGATGTGAGGGTTCATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006782
VALIDATED
ZFPL1 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-281s1c1
Sequence:CCGGGCTCCAAGATAGCGACTACAACTCGAGTTGTAGTCGCTATCTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-792s1c1
Sequence:CCGGGTGTATGATACGCGGGATGATCTCGAGATCATCCCGCGTATCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-604s1c1
Sequence:CCGGCTGACTTCTCTGACTGGTCTACTCGAGTAGACCAGTCAGAGAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-353s1c1
Sequence:CCGGCCTTGTCTGCTATGATCTCTTCTCGAGAAGAGATCATAGCAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006782.2-1046s1c1
Sequence:CCGGCCCACTCATGAACCCTCACATCTCGAGATGTGAGGGTTCATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006782.3-805s21c1
Sequence:CCGGGTGTATGATACGCGGGATGATCTCGAGATCATCCCGCGTATCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006782.3-366s21c1
Sequence:CCGGCCTTGTCTGCTATGATCTCTTCTCGAGAAGAGATCATAGCAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006782.3-617s21c1
Sequence:CCGGCTGACTTCTCTGACTGGTCTACTCGAGTAGACCAGTCAGAGAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006782.3-294s21c1
Sequence:CCGGGCTCCAAGATAGCGACTACAACTCGAGTTGTAGTCGCTATCTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006782.3-1059s21c1
Sequence:CCGGCCCACTCATGAACCCTCACATCTCGAGATGTGAGGGTTCATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks