EMAIL THIS PAGE TO A FRIEND

ZFPM1

zinc finger protein, FOG family member 1

Synonyms: FOG FOG1 ZC2HC11A ZNF408 ZNF89A
UniProtKB ID: Q8IX07
Gene ID:
Mouse(22761) zinc finger protein, multitype 1
Rat(691504) zinc finger protein, multitype 1
Zebrafish(407655) zinc finger protein, multitype 1
chicken(415835) zinc finger protein, multitype 1
dog(100684205) zinc finger protein, multitype 1
domestic cat(101096938) zinc finger protein, multitype 1
cow(528338) zinc finger protein, FOG family member 1
naked mole-rat(101718410) zinc finger protein, FOG family member 1
domestic guinea pig(100734849) zinc finger protein, FOG family member 1
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153813 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149961 MISSION® esiRNA esiRNA human ZFPM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153813 Rosetta Predictions human pricing
XR_007127 Rosetta Predictions rat pricing
NM_009569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199534 predicted 536
2 SASI_Hs01_00199535 predicted 1125
3 SASI_Hs01_00199536 predicted 1162
4 SASI_Hs01_00199537 predicted 1102
5 SASI_Hs01_00199538 predicted 379
6 SASI_Hs01_00199539 predicted 1218
7 SASI_Hs01_00199540 predicted 861
8 SASI_Hs01_00199541 predicted 328
9 SASI_Hs01_00199542 predicted 722
10 SASI_Hs02_00367493 predicted 802
11 SASI_Hs01_00199543 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154540 predicted 494
2 SASI_Rn01_00154541 predicted 856
3 SASI_Rn01_00154544 predicted 2488
4 SASI_Rn01_00154545 predicted 1569
5 SASI_Rn01_00154546 predicted 2295
6 SASI_Rn01_00154547 predicted 1095
7 SASI_Rn01_00154548 predicted 1108
8 SASI_Rn01_00154549 predicted 1603
9 SASI_Rn02_00413814 predicted 337
10 SASI_Rn02_00413815 predicted 1901
11 SASI_Rn01_00154542 predicted 918
12 SASI_Rn01_00154543 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055242 predicted 1546
2 SASI_Mm01_00055243 predicted 1476
3 SASI_Mm01_00055244 predicted 2120
4 SASI_Mm01_00055245 predicted 976
5 SASI_Mm01_00055246 predicted 894
6 SASI_Mm02_00316436 predicted 1452
7 SASI_Mm01_00055247 predicted 2888
8 SASI_Mm02_00316437 predicted 734
9 SASI_Mm01_00055248 predicted 1447
10 SASI_Mm01_00055249 predicted 1410
11 SASI_Mm01_00055250 predicted 1203
12 SASI_Mm01_00055251 predicted 2608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153813
ZFPM1 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein, FOG family member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153813.2-1605s21c1
Sequence:CCGGGTTCCTTCCGCAGTACGTGTTCTCGAGAACACGTACTGCGGAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153813.2-2960s21c1
Sequence:CCGGGCCGTCTTTGCAACATCAAGTCTCGAGACTTGATGTTGCAAAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-2068s1c1
Sequence:CCGGCACCTTCAGCAACGTCAACAACTCGAGTTGTTGACGTTGCTGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-1016s1c1
Sequence:CCGGGCCACCGCAGTGATCAACAAACTCGAGTTTGTTGATCACTGCGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-809s1c1
Sequence:CCGGACAGAGATCCACAGGAAGGATCTCGAGATCCTTCCTGTGGATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-1417s1c1
Sequence:CCGGCCACTTGGTCACCAACCACATCTCGAGATGTGGTTGGTGACCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-2401s1c1
Sequence:CCGGCGAGACCTACACCGTGCACAACTCGAGTTGTGCACGGTGTAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153813
ZFPM1 MISSION shRNA shRNA Plasmid DNA
zinc finger protein, FOG family member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153813.2-1605s21c1
Sequence:CCGGGTTCCTTCCGCAGTACGTGTTCTCGAGAACACGTACTGCGGAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153813.2-2960s21c1
Sequence:CCGGGCCGTCTTTGCAACATCAAGTCTCGAGACTTGATGTTGCAAAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-2068s1c1
Sequence:CCGGCACCTTCAGCAACGTCAACAACTCGAGTTGTTGACGTTGCTGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-1016s1c1
Sequence:CCGGGCCACCGCAGTGATCAACAAACTCGAGTTTGTTGATCACTGCGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-809s1c1
Sequence:CCGGACAGAGATCCACAGGAAGGATCTCGAGATCCTTCCTGTGGATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-1417s1c1
Sequence:CCGGCCACTTGGTCACCAACCACATCTCGAGATGTGGTTGGTGACCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-2401s1c1
Sequence:CCGGCGAGACCTACACCGTGCACAACTCGAGTTGTGCACGGTGTAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153813
ZFPM1 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein, FOG family member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153813.2-1605s21c1
Sequence:CCGGGTTCCTTCCGCAGTACGTGTTCTCGAGAACACGTACTGCGGAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153813.2-2960s21c1
Sequence:CCGGGCCGTCTTTGCAACATCAAGTCTCGAGACTTGATGTTGCAAAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-2068s1c1
Sequence:CCGGCACCTTCAGCAACGTCAACAACTCGAGTTGTTGACGTTGCTGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-1016s1c1
Sequence:CCGGGCCACCGCAGTGATCAACAAACTCGAGTTTGTTGATCACTGCGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-809s1c1
Sequence:CCGGACAGAGATCCACAGGAAGGATCTCGAGATCCTTCCTGTGGATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-1417s1c1
Sequence:CCGGCCACTTGGTCACCAACCACATCTCGAGATGTGGTTGGTGACCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153813.1-2401s1c1
Sequence:CCGGCGAGACCTACACCGTGCACAACTCGAGTTGTGCACGGTGTAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009569
ZFPM1 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein, FOG family member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-2131s1c1
Sequence:CCGGCGAGATCACCTTTAACAATATCTCGAGATATTGTTAAAGGTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-2130s1c1
Sequence:CCGGGCGAGATCACCTTTAACAATACTCGAGTATTGTTAAAGGTGATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-1443s1c1
Sequence:CCGGGTGGCTTCATATCCACCACAACTCGAGTTGTGGTGGATATGAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-1931s1c1
Sequence:CCGGACACTCTTTCTGCCACAATATCTCGAGATATTGTGGCAGAAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-2470s1c1
Sequence:CCGGCGAAACCTACACTGTGCACAACTCGAGTTGTGCACAGTGTAGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009569
ZFPM1 MISSION shRNA shRNA Plasmid DNA
zinc finger protein, FOG family member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-2131s1c1
Sequence:CCGGCGAGATCACCTTTAACAATATCTCGAGATATTGTTAAAGGTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-2130s1c1
Sequence:CCGGGCGAGATCACCTTTAACAATACTCGAGTATTGTTAAAGGTGATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-1443s1c1
Sequence:CCGGGTGGCTTCATATCCACCACAACTCGAGTTGTGGTGGATATGAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-1931s1c1
Sequence:CCGGACACTCTTTCTGCCACAATATCTCGAGATATTGTGGCAGAAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-2470s1c1
Sequence:CCGGCGAAACCTACACTGTGCACAACTCGAGTTGTGCACAGTGTAGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009569
ZFPM1 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein, FOG family member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-2131s1c1
Sequence:CCGGCGAGATCACCTTTAACAATATCTCGAGATATTGTTAAAGGTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-2130s1c1
Sequence:CCGGGCGAGATCACCTTTAACAATACTCGAGTATTGTTAAAGGTGATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-1443s1c1
Sequence:CCGGGTGGCTTCATATCCACCACAACTCGAGTTGTGGTGGATATGAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-1931s1c1
Sequence:CCGGACACTCTTTCTGCCACAATATCTCGAGATATTGTGGCAGAAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009569.1-2470s1c1
Sequence:CCGGCGAAACCTACACTGTGCACAACTCGAGTTGTGCACAGTGTAGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks