EMAIL THIS PAGE TO A FRIEND

ZFPM2

zinc finger protein, FOG family member 2

Synonyms: DIH3 FOG2 ZC2HC11B ZNF89B hFOG-2
UniProtKB ID: Q8WW38, Q32MA6, Q9NPL7, Q9NPS4, Q9UNI5
Gene ID:
Human(23414) Summary: The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
Mouse(22762) zinc finger protein, multitype 2
Rat(314930) zinc finger protein, multitype 2
domestic guinea pig(100716965) zinc finger protein, FOG family member 2
naked mole-rat(101725037) zinc finger protein, FOG family member 2
cow(784747) zinc finger protein, FOG family member 2
sheep(101121179) zinc finger protein, multitype 2
chicken(420269) zinc finger protein, multitype 2
Horse(100063119) zinc finger protein, multitype 2
dog(481997) zinc finger protein, multitype 2
171 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011766 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011766 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011766 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012082 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012082 Rosetta Predictions human pricing
NM_001130501 Rosetta Predictions rat pricing
NM_011766 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137814 predicted 746
2 SASI_Hs01_00137815 predicted 1629
3 SASI_Hs01_00137816 predicted 2741
4 SASI_Hs02_00343564 predicted 1887
5 SASI_Hs01_00137818 predicted 756
6 SASI_Hs01_00137819 predicted 2395
7 SASI_Hs01_00137820 predicted 3211
8 SASI_Hs01_00137822 predicted 1257
9 SASI_Hs01_00137823 predicted 646
10 SASI_Hs02_00343565 predicted 1668
11 SASI_Hs01_00137817 predicted 2066
12 SASI_Hs01_00137821 predicted 2696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255439 predicted 3479
2 SASI_Rn02_00255440 predicted 2543
3 SASI_Rn02_00255441 predicted 1245
4 SASI_Rn02_00255442 predicted 2155
5 SASI_Rn02_00255443 predicted 3887
6 SASI_Rn02_00255444 predicted 2108
7 SASI_Rn02_00255445 predicted 2373
8 SASI_Rn02_00255446 predicted 2380
9 SASI_Rn02_00255447 predicted 2186
10 SASI_Rn02_00255448 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142049 predicted 1776
2 SASI_Mm01_00142050 predicted 1031
3 SASI_Mm01_00142051 predicted 3033
4 SASI_Mm01_00142053 predicted 1985
5 SASI_Mm01_00142054 predicted 3265
6 SASI_Mm02_00321389 predicted 3866
7 SASI_Mm01_00142055 predicted 2875
8 SASI_Mm02_00321390 predicted 2535
9 SASI_Mm01_00142056 predicted 1240
10 SASI_Mm01_00142058 predicted 3785
11 SASI_Mm01_00142052 predicted 3878
12 SASI_Mm01_00142057 predicted 2116
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011766
VALIDATED
ZFPM2 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein, FOG family member 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011766.2-4549s1c1
Sequence:CCGGGCCGTATATTTCTGTCCATTTCTCGAGAAATGGACAGAAATATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011766.2-2714s1c1
Sequence:CCGGGCGAAGAAAGATGTACGAAATCTCGAGATTTCGTACATCTTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011766.2-3790s1c1
Sequence:CCGGGCGCAGAAGAACAGTTGTCTACTCGAGTAGACAACTGTTCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011766.2-2363s1c1
Sequence:CCGGCCTTCAAACATCCTGCATCAACTCGAGTTGATGCAGGATGTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011766.2-1223s1c1
Sequence:CCGGGCCTACAGCTATTGTCAATAACTCGAGTTATTGACAATAGCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011766.5-2713s21c1
Sequence:CCGGGCGAAGAAAGATGTACGAAATCTCGAGATTTCGTACATCTTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011766.5-1222s21c1
Sequence:CCGGGCCTACAGCTATTGTCAATAACTCGAGTTATTGACAATAGCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011766.5-3459s21c1
Sequence:CCGGGGATAAAGCCAAGCGATTATACTCGAGTATAATCGCTTGGCTTTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011766.5-4549s21c1
Sequence:CCGGGCCGTATATTTCTGTCCATTTCTCGAGAAATGGACAGAAATATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011766
VALIDATED
ZFPM2 MISSION shRNA shRNA Plasmid DNA
zinc finger protein, FOG family member 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011766.2-4549s1c1
Sequence:CCGGGCCGTATATTTCTGTCCATTTCTCGAGAAATGGACAGAAATATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011766.2-2714s1c1
Sequence:CCGGGCGAAGAAAGATGTACGAAATCTCGAGATTTCGTACATCTTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011766.2-3790s1c1
Sequence:CCGGGCGCAGAAGAACAGTTGTCTACTCGAGTAGACAACTGTTCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011766.2-2363s1c1
Sequence:CCGGCCTTCAAACATCCTGCATCAACTCGAGTTGATGCAGGATGTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011766.2-1223s1c1
Sequence:CCGGGCCTACAGCTATTGTCAATAACTCGAGTTATTGACAATAGCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011766.5-2713s21c1
Sequence:CCGGGCGAAGAAAGATGTACGAAATCTCGAGATTTCGTACATCTTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011766.5-1222s21c1
Sequence:CCGGGCCTACAGCTATTGTCAATAACTCGAGTTATTGACAATAGCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011766.5-3459s21c1
Sequence:CCGGGGATAAAGCCAAGCGATTATACTCGAGTATAATCGCTTGGCTTTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011766.5-4549s21c1
Sequence:CCGGGCCGTATATTTCTGTCCATTTCTCGAGAAATGGACAGAAATATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011766
VALIDATED
ZFPM2 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein, FOG family member 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011766.2-4549s1c1
Sequence:CCGGGCCGTATATTTCTGTCCATTTCTCGAGAAATGGACAGAAATATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011766.2-2714s1c1
Sequence:CCGGGCGAAGAAAGATGTACGAAATCTCGAGATTTCGTACATCTTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011766.2-3790s1c1
Sequence:CCGGGCGCAGAAGAACAGTTGTCTACTCGAGTAGACAACTGTTCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011766.2-2363s1c1
Sequence:CCGGCCTTCAAACATCCTGCATCAACTCGAGTTGATGCAGGATGTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011766.2-1223s1c1
Sequence:CCGGGCCTACAGCTATTGTCAATAACTCGAGTTATTGACAATAGCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011766.5-2713s21c1
Sequence:CCGGGCGAAGAAAGATGTACGAAATCTCGAGATTTCGTACATCTTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011766.5-1222s21c1
Sequence:CCGGGCCTACAGCTATTGTCAATAACTCGAGTTATTGACAATAGCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011766.5-3459s21c1
Sequence:CCGGGGATAAAGCCAAGCGATTATACTCGAGTATAATCGCTTGGCTTTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011766.5-4549s21c1
Sequence:CCGGGCCGTATATTTCTGTCCATTTCTCGAGAAATGGACAGAAATATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012082
ZFPM2 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein, FOG family member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-744s1c1
Sequence:CCGGGCCCACAGCTATTGTCAATAACTCGAGTTATTGACAATAGCTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-2121s1c1
Sequence:CCGGCGAAACATACATGGTCCACAACTCGAGTTGTGGACCATGTATGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-1256s1c1
Sequence:CCGGCCACAGACTTATTGACCAGAACTCGAGTTCTGGTCAATAAGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-2747s1c1
Sequence:CCGGGCTACGAAAGAAGCATAATAACTCGAGTTATTATGCTTCTTTCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-164s1c1
Sequence:CCGGCCACAGAATTTGGGCCTGAAACTCGAGTTTCAGGCCCAAATTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012082.3-1139s21c1
Sequence:CCGGCCAGACTCAGAGGGAGTTATTCTCGAGAATAACTCCCTCTGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012082.3-1101s21c1
Sequence:CCGGCAAGCTGCCTTCCGATGTAATCTCGAGATTACATCGGAAGGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012082
ZFPM2 MISSION shRNA shRNA Plasmid DNA
zinc finger protein, FOG family member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-744s1c1
Sequence:CCGGGCCCACAGCTATTGTCAATAACTCGAGTTATTGACAATAGCTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-2121s1c1
Sequence:CCGGCGAAACATACATGGTCCACAACTCGAGTTGTGGACCATGTATGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-1256s1c1
Sequence:CCGGCCACAGACTTATTGACCAGAACTCGAGTTCTGGTCAATAAGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-2747s1c1
Sequence:CCGGGCTACGAAAGAAGCATAATAACTCGAGTTATTATGCTTCTTTCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-164s1c1
Sequence:CCGGCCACAGAATTTGGGCCTGAAACTCGAGTTTCAGGCCCAAATTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012082.3-1139s21c1
Sequence:CCGGCCAGACTCAGAGGGAGTTATTCTCGAGAATAACTCCCTCTGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012082.3-1101s21c1
Sequence:CCGGCAAGCTGCCTTCCGATGTAATCTCGAGATTACATCGGAAGGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012082
ZFPM2 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein, FOG family member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-744s1c1
Sequence:CCGGGCCCACAGCTATTGTCAATAACTCGAGTTATTGACAATAGCTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-2121s1c1
Sequence:CCGGCGAAACATACATGGTCCACAACTCGAGTTGTGGACCATGTATGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-1256s1c1
Sequence:CCGGCCACAGACTTATTGACCAGAACTCGAGTTCTGGTCAATAAGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-2747s1c1
Sequence:CCGGGCTACGAAAGAAGCATAATAACTCGAGTTATTATGCTTCTTTCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012082.2-164s1c1
Sequence:CCGGCCACAGAATTTGGGCCTGAAACTCGAGTTTCAGGCCCAAATTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012082.3-1139s21c1
Sequence:CCGGCCAGACTCAGAGGGAGTTATTCTCGAGAATAACTCCCTCTGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012082.3-1101s21c1
Sequence:CCGGCAAGCTGCCTTCCGATGTAATCTCGAGATTACATCGGAAGGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks