EMAIL THIS PAGE TO A FRIEND

ZFR2

zinc finger RNA binding protein 2

Synonyms: KIAA1086
UniProtKB ID: Q9UPR6
Gene ID:
Mouse(103406) zinc finger RNA binding protein 2
Rat(314639) zinc finger RNA binding protein 2
Zebrafish(567465) zinc finger RNA binding protein 2
dog(485051) zinc finger RNA binding protein 2
domestic cat(101099276) zinc finger RNA binding protein 2
cow(618380) zinc finger RNA binding protein 2
naked mole-rat(101704322) zinc finger RNA binding protein 2
domestic guinea pig(100729484) zinc finger RNA binding protein 2
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015174 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU156771 MISSION® esiRNA esiRNA targeting mouse Zfr2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015174 Rosetta Predictions human pricing
XM_047610 Rosetta Predictions human pricing
XM_001070148 Rosetta Predictions rat pricing
XM_234923 Rosetta Predictions rat pricing
NM_001034895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347180 predicted 1197
2 SASI_Hs02_00347181 predicted 2187
3 SASI_Hs02_00347182 predicted 1549
4 SASI_Hs02_00347183 predicted 1041
5 SASI_Hs02_00347184 predicted 2197
6 SASI_Hs02_00347185 predicted 310
7 SASI_Hs02_00347186 predicted 1871
8 SASI_Hs02_00347187 predicted 1963
9 SASI_Hs02_00347188 predicted 256
10 SASI_Hs02_00347189 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_047610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264147 predicted 1470
2 SASI_Hs01_00264148 predicted 2452
3 SASI_Hs01_00264149 predicted 213
4 SASI_Hs01_00264150 predicted 2857
5 SASI_Hs01_00264151 predicted 246
6 SASI_Hs01_00264152 predicted 2469
7 SASI_Hs01_00264153 predicted 1310
8 SASI_Hs01_00264154 predicted 575
9 SASI_Hs01_00264155 predicted 2142
10 SASI_Hs01_00264156 predicted 2235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330586 predicted 1031
2 SASI_Rn02_00330587 predicted 2675
3 SASI_Rn02_00330588 predicted 2367
4 SASI_Rn02_00330589 predicted 1104
5 SASI_Rn02_00330590 predicted 2023
6 SASI_Rn02_00330591 predicted 1457
7 SASI_Rn02_00330592 predicted 798
8 SASI_Rn02_00330593 predicted 2500
9 SASI_Rn02_00330594 predicted 2485
10 SASI_Rn02_00330595 predicted 2705
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388778 predicted 1034
2 SASI_Rn02_00388779 predicted 465
3 SASI_Rn02_00388780 predicted 902
4 SASI_Rn02_00388781 predicted 910
5 SASI_Rn02_00388782 predicted 1095
6 SASI_Rn02_00388783 predicted 1455
7 SASI_Rn02_00388784 predicted 794
8 SASI_Rn02_00388785 predicted 1456
9 SASI_Rn02_00388786 predicted 1071
10 SASI_Rn02_00388787 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289169 predicted 1176
2 SASI_Mm02_00289170 predicted 2521
3 SASI_Mm02_00289171 predicted 968
4 SASI_Mm02_00289172 predicted 1307
5 SASI_Mm02_00289173 predicted 1424
6 SASI_Mm02_00289174 predicted 1691
7 SASI_Mm02_00289175 predicted 853
8 SASI_Mm02_00289176 predicted 2470
9 SASI_Mm02_00289177 predicted 1616
10 SASI_Mm02_00289178 predicted 2517
11 SASI_Mm01_00132092 predicted 624
12 SASI_Mm01_00132093 predicted 1187
13 SASI_Mm01_00132094 predicted 1055
14 SASI_Mm01_00132095 predicted 977
15 SASI_Mm01_00132096 predicted 1034
16 SASI_Mm01_00132097 predicted 972
17 SASI_Mm01_00132098 predicted 1029
18 SASI_Mm01_00132099 predicted 1045
19 SASI_Mm01_00132100 predicted 966
20 SASI_Mm01_00132101 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034895
ZFR2 MISSION shRNA Bacterial Glycerol Stock
zinc finger RNA binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034895.3-1615s21c1
Sequence:CCGGGACCGTCATGTCATGTGTAAGCTCGAGCTTACACATGACATGACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034895.3-2527s21c1
Sequence:CCGGTTACCTCCACGGACCAGATTCCTCGAGGAATCTGGTCCGTGGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034895.3-3153s21c1
Sequence:CCGGTGGACACAGCTCTATCCATTACTCGAGTAATGGATAGAGCTGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034895.3-2043s21c1
Sequence:CCGGGCGGGAAGATCCCTCTGTAAACTCGAGTTTACAGAGGGATCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034895.3-1961s21c1
Sequence:CCGGCTGACCATGACGCCAACATTGCTCGAGCAATGTTGGCGTCATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034895
ZFR2 MISSION shRNA shRNA Plasmid DNA
zinc finger RNA binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034895.3-1615s21c1
Sequence:CCGGGACCGTCATGTCATGTGTAAGCTCGAGCTTACACATGACATGACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034895.3-2527s21c1
Sequence:CCGGTTACCTCCACGGACCAGATTCCTCGAGGAATCTGGTCCGTGGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034895.3-3153s21c1
Sequence:CCGGTGGACACAGCTCTATCCATTACTCGAGTAATGGATAGAGCTGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034895.3-2043s21c1
Sequence:CCGGGCGGGAAGATCCCTCTGTAAACTCGAGTTTACAGAGGGATCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034895.3-1961s21c1
Sequence:CCGGCTGACCATGACGCCAACATTGCTCGAGCAATGTTGGCGTCATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034895
ZFR2 MISSION shRNA Lentiviral Transduction Particles
zinc finger RNA binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034895.3-1615s21c1
Sequence:CCGGGACCGTCATGTCATGTGTAAGCTCGAGCTTACACATGACATGACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034895.3-2527s21c1
Sequence:CCGGTTACCTCCACGGACCAGATTCCTCGAGGAATCTGGTCCGTGGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034895.3-3153s21c1
Sequence:CCGGTGGACACAGCTCTATCCATTACTCGAGTAATGGATAGAGCTGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034895.3-2043s21c1
Sequence:CCGGGCGGGAAGATCCCTCTGTAAACTCGAGTTTACAGAGGGATCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034895.3-1961s21c1
Sequence:CCGGCTGACCATGACGCCAACATTGCTCGAGCAATGTTGGCGTCATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015174
ZFR2 MISSION shRNA Bacterial Glycerol Stock
zinc finger RNA binding protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015174.1-2117s21c1
Sequence:CCGGTGGTGACCGAGGATGAGTATGCTCGAGCATACTCATCCTCGGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015174.1-1434s21c1
Sequence:CCGGGTGCAGTTTCAACGACCTTAACTCGAGTTAAGGTCGTTGAAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015174.1-2916s21c1
Sequence:CCGGGACGTTGGACAATGGTCATTTCTCGAGAAATGACCATTGTCCAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015174.1-611s21c1
Sequence:CCGGCACCAAGCTACCCGAACTATGCTCGAGCATAGTTCGGGTAGCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015174.1-1269s21c1
Sequence:CCGGGAAACCAGCCCAACCTAAATTCTCGAGAATTTAGGTTGGGCTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015174
ZFR2 MISSION shRNA shRNA Plasmid DNA
zinc finger RNA binding protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015174.1-2117s21c1
Sequence:CCGGTGGTGACCGAGGATGAGTATGCTCGAGCATACTCATCCTCGGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015174.1-1434s21c1
Sequence:CCGGGTGCAGTTTCAACGACCTTAACTCGAGTTAAGGTCGTTGAAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015174.1-2916s21c1
Sequence:CCGGGACGTTGGACAATGGTCATTTCTCGAGAAATGACCATTGTCCAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015174.1-611s21c1
Sequence:CCGGCACCAAGCTACCCGAACTATGCTCGAGCATAGTTCGGGTAGCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015174.1-1269s21c1
Sequence:CCGGGAAACCAGCCCAACCTAAATTCTCGAGAATTTAGGTTGGGCTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015174
ZFR2 MISSION shRNA Lentiviral Transduction Particles
zinc finger RNA binding protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015174.1-2117s21c1
Sequence:CCGGTGGTGACCGAGGATGAGTATGCTCGAGCATACTCATCCTCGGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015174.1-1434s21c1
Sequence:CCGGGTGCAGTTTCAACGACCTTAACTCGAGTTAAGGTCGTTGAAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015174.1-2916s21c1
Sequence:CCGGGACGTTGGACAATGGTCATTTCTCGAGAAATGACCATTGTCCAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015174.1-611s21c1
Sequence:CCGGCACCAAGCTACCCGAACTATGCTCGAGCATAGTTCGGGTAGCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015174.1-1269s21c1
Sequence:CCGGGAAACCAGCCCAACCTAAATTCTCGAGAATTTAGGTTGGGCTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks