EMAIL THIS PAGE TO A FRIEND

ZFR

zinc finger RNA binding protein

Synonyms: ZFR1
Gene ID:
Mouse(22763) zinc finger RNA binding protein
Rat(365703) zinc finger RNA binding protein
domestic guinea pig(100724851) zinc finger RNA binding protein
naked mole-rat(101723586) zinc finger RNA binding protein
Domestic Rabbit(100352849) zinc finger RNA binding protein
cow(538494) zinc finger RNA binding protein
sheep(101118901) zinc finger RNA binding protein
Zebrafish(321659) zinc finger RNA binding protein
domestic cat(101080947) zinc finger RNA binding protein
dog(489239) zinc finger RNA binding protein
chicken(427424) zinc finger RNA binding protein
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA016666 Anti-ZFR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV39227 Anti-ZFR antibody produced in rabbit affinity isolated antibody , human, rabbit, canine, zebrafish, mouse, horse, rat
western blot pricing
SAB2104153 Anti-ZFR antibody produced in rabbit affinity isolated antibody horse, zebrafish, canine, mouse, rabbit, human, rat
western blot pricing
SAB2106463 Anti-ZFR antibody produced in rabbit affinity isolated antibody rabbit, mouse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016107 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130481 MISSION® esiRNA esiRNA human ZFR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016107 Rosetta Predictions human pricing
XM_001056210 Rosetta Predictions rat pricing
XM_345169 Rosetta Predictions rat pricing
NM_011767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074753 predicted 1452
2 SASI_Hs01_00074754 predicted 2610
3 SASI_Hs01_00074755 predicted 418
4 SASI_Hs01_00074756 predicted 2220
5 SASI_Hs02_00348877 predicted 1665
6 SASI_Hs01_00074757 predicted 3128
7 SASI_Hs02_00348878 predicted 1411
8 SASI_Hs02_00348879 predicted 2916
9 SASI_Hs01_00074759 predicted 2414
10 SASI_Hs01_00074760 predicted 1455
11 SASI_Hs01_00074758 predicted 2575
12 SASI_Hs01_00074761 predicted 2725
13 SASI_Hs01_00074762 predicted 3217
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282438 predicted 419
2 SASI_Rn02_00282439 predicted 1368
3 SASI_Rn02_00282440 predicted 2177
4 SASI_Rn02_00282441 predicted 3046
5 SASI_Rn02_00282442 predicted 3006
6 SASI_Rn02_00282443 predicted 1159
7 SASI_Rn02_00282444 predicted 2884
8 SASI_Rn02_00282445 predicted 2790
9 SASI_Rn02_00282446 predicted 1355
10 SASI_Rn02_00282447 predicted 2598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398041 predicted 3794
2 SASI_Rn02_00398042 predicted 3284
3 SASI_Rn02_00398043 predicted 3682
4 SASI_Rn02_00398044 predicted 3248
5 SASI_Rn02_00398045 predicted 3205
6 SASI_Rn02_00398046 predicted 3866
7 SASI_Rn02_00398047 predicted 3556
8 SASI_Rn02_00398048 predicted 3288
9 SASI_Rn02_00398049 predicted 3392
10 SASI_Rn02_00398050 predicted 3265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032104 predicted 1475
2 SASI_Mm01_00032106 predicted 3040
3 SASI_Mm01_00032105 predicted 3104
4 SASI_Mm01_00032107 predicted 2982
5 SASI_Mm01_00032108 predicted 2276
6 SASI_Mm01_00032110 predicted 3152
7 SASI_Mm01_00032111 predicted 2700
8 SASI_Mm01_00032112 predicted 1453
9 SASI_Mm02_00321391 predicted 1332
10 SASI_Mm02_00321392 predicted 2444
11 SASI_Mm01_00032109 predicted 2518
12 SASI_Mm01_00032113 predicted 2785
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016107
VALIDATED
ZFR MISSION shRNA Bacterial Glycerol Stock
zinc finger RNA binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016107.3-1949s21c1
Sequence:CCGGGCCTAGTATTCGAGCAAGAAACTCGAGTTTCTTGCTCGAATACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016107.3-3451s21c1
Sequence:CCGGTGTACAGTGTTAGGTATTATTCTCGAGAATAATACCTAACACTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016107.3-664s21c1
Sequence:CCGGGCCAAGGTGCAACTCAGTATACTCGAGTATACTGAGTTGCACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016107.3-1107s21c1
Sequence:CCGGCCACAGACTTATAAAGAACATCTCGAGATGTTCTTTATAAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016107.3-2588s21c1
Sequence:CCGGCCCTGAGAAGTATGACATAAACTCGAGTTTATGTCATACTTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016107.3-2274s1c1
Sequence:CCGGGCCACCATTTATCCAACTGAACTCGAGTTCAGTTGGATAAATGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016107.3-1107s1c1
Sequence:CCGGCCACAGACTTATAAAGAACATCTCGAGATGTTCTTTATAAGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016107.3-2588s1c1
Sequence:CCGGCCCTGAGAAGTATGACATAAACTCGAGTTTATGTCATACTTCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016107.3-1949s1c1
Sequence:CCGGGCCTAGTATTCGAGCAAGAAACTCGAGTTTCTTGCTCGAATACTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016107.3-664s1c1
Sequence:CCGGGCCAAGGTGCAACTCAGTATACTCGAGTATACTGAGTTGCACCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016107
VALIDATED
ZFR MISSION shRNA shRNA Plasmid DNA
zinc finger RNA binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016107.3-1949s21c1
Sequence:CCGGGCCTAGTATTCGAGCAAGAAACTCGAGTTTCTTGCTCGAATACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016107.3-3451s21c1
Sequence:CCGGTGTACAGTGTTAGGTATTATTCTCGAGAATAATACCTAACACTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016107.3-664s21c1
Sequence:CCGGGCCAAGGTGCAACTCAGTATACTCGAGTATACTGAGTTGCACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016107.3-1107s21c1
Sequence:CCGGCCACAGACTTATAAAGAACATCTCGAGATGTTCTTTATAAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016107.3-2588s21c1
Sequence:CCGGCCCTGAGAAGTATGACATAAACTCGAGTTTATGTCATACTTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016107.3-2274s1c1
Sequence:CCGGGCCACCATTTATCCAACTGAACTCGAGTTCAGTTGGATAAATGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016107.3-1107s1c1
Sequence:CCGGCCACAGACTTATAAAGAACATCTCGAGATGTTCTTTATAAGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016107.3-2588s1c1
Sequence:CCGGCCCTGAGAAGTATGACATAAACTCGAGTTTATGTCATACTTCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016107.3-1949s1c1
Sequence:CCGGGCCTAGTATTCGAGCAAGAAACTCGAGTTTCTTGCTCGAATACTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016107.3-664s1c1
Sequence:CCGGGCCAAGGTGCAACTCAGTATACTCGAGTATACTGAGTTGCACCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016107
VALIDATED
ZFR MISSION shRNA Lentiviral Transduction Particles
zinc finger RNA binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016107.3-1949s21c1
Sequence:CCGGGCCTAGTATTCGAGCAAGAAACTCGAGTTTCTTGCTCGAATACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016107.3-3451s21c1
Sequence:CCGGTGTACAGTGTTAGGTATTATTCTCGAGAATAATACCTAACACTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016107.3-664s21c1
Sequence:CCGGGCCAAGGTGCAACTCAGTATACTCGAGTATACTGAGTTGCACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016107.3-1107s21c1
Sequence:CCGGCCACAGACTTATAAAGAACATCTCGAGATGTTCTTTATAAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016107.3-2588s21c1
Sequence:CCGGCCCTGAGAAGTATGACATAAACTCGAGTTTATGTCATACTTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016107.3-2274s1c1
Sequence:CCGGGCCACCATTTATCCAACTGAACTCGAGTTCAGTTGGATAAATGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016107.3-1107s1c1
Sequence:CCGGCCACAGACTTATAAAGAACATCTCGAGATGTTCTTTATAAGTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016107.3-2588s1c1
Sequence:CCGGCCCTGAGAAGTATGACATAAACTCGAGTTTATGTCATACTTCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016107.3-1949s1c1
Sequence:CCGGGCCTAGTATTCGAGCAAGAAACTCGAGTTTCTTGCTCGAATACTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016107.3-664s1c1
Sequence:CCGGGCCAAGGTGCAACTCAGTATACTCGAGTATACTGAGTTGCACCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011767
VALIDATED
ZFR MISSION shRNA Bacterial Glycerol Stock
zinc finger RNA binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011767.2-3428s21c1
Sequence:CCGGTTGTACAGTGTCAGGTATTATCTCGAGATAATACCTGACACTGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011767.2-859s21c1
Sequence:CCGGGGTTATGAAGCAGCCGTATATCTCGAGATATACGGCTGCTTCATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011767.2-2542s21c1
Sequence:CCGGCTACCCAAACAGCTTGCTGTTCTCGAGAACAGCAAGCTGTTTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011767.2-3166s21c1
Sequence:CCGGCCACAAATGAATCAGCGCTTTCTCGAGAAAGCGCTGATTCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011767.2-1139s21c1
Sequence:CCGGCCGCATTGAAAGCCTCTCAAACTCGAGTTTGAGAGGCTTTCAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011767.1-3437s1c1
Sequence:CCGGCAGGTATTATATGGGTGGAAACTCGAGTTTCCACCCATATAATACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011767.1-1137s1c1
Sequence:CCGGCCGCATTGAAAGCCTCTCAAACTCGAGTTTGAGAGGCTTTCAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011767.1-2540s1c1
Sequence:CCGGCTACCCAAACAGCTTGCTGTTCTCGAGAACAGCAAGCTGTTTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011767.1-3164s1c1
Sequence:CCGGCCACAAATGAATCAGCGCTTTCTCGAGAAAGCGCTGATTCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011767.1-2252s1c1
Sequence:CCGGGCAACTATTTATCCAACTGAACTCGAGTTCAGTTGGATAAATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011767
VALIDATED
ZFR MISSION shRNA shRNA Plasmid DNA
zinc finger RNA binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011767.2-3428s21c1
Sequence:CCGGTTGTACAGTGTCAGGTATTATCTCGAGATAATACCTGACACTGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011767.2-859s21c1
Sequence:CCGGGGTTATGAAGCAGCCGTATATCTCGAGATATACGGCTGCTTCATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011767.2-2542s21c1
Sequence:CCGGCTACCCAAACAGCTTGCTGTTCTCGAGAACAGCAAGCTGTTTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011767.2-3166s21c1
Sequence:CCGGCCACAAATGAATCAGCGCTTTCTCGAGAAAGCGCTGATTCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011767.2-1139s21c1
Sequence:CCGGCCGCATTGAAAGCCTCTCAAACTCGAGTTTGAGAGGCTTTCAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011767.1-3437s1c1
Sequence:CCGGCAGGTATTATATGGGTGGAAACTCGAGTTTCCACCCATATAATACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011767.1-1137s1c1
Sequence:CCGGCCGCATTGAAAGCCTCTCAAACTCGAGTTTGAGAGGCTTTCAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011767.1-2540s1c1
Sequence:CCGGCTACCCAAACAGCTTGCTGTTCTCGAGAACAGCAAGCTGTTTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011767.1-3164s1c1
Sequence:CCGGCCACAAATGAATCAGCGCTTTCTCGAGAAAGCGCTGATTCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011767.1-2252s1c1
Sequence:CCGGGCAACTATTTATCCAACTGAACTCGAGTTCAGTTGGATAAATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011767
VALIDATED
ZFR MISSION shRNA Lentiviral Transduction Particles
zinc finger RNA binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011767.2-3428s21c1
Sequence:CCGGTTGTACAGTGTCAGGTATTATCTCGAGATAATACCTGACACTGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011767.2-859s21c1
Sequence:CCGGGGTTATGAAGCAGCCGTATATCTCGAGATATACGGCTGCTTCATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011767.2-2542s21c1
Sequence:CCGGCTACCCAAACAGCTTGCTGTTCTCGAGAACAGCAAGCTGTTTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011767.2-3166s21c1
Sequence:CCGGCCACAAATGAATCAGCGCTTTCTCGAGAAAGCGCTGATTCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011767.2-1139s21c1
Sequence:CCGGCCGCATTGAAAGCCTCTCAAACTCGAGTTTGAGAGGCTTTCAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011767.1-3437s1c1
Sequence:CCGGCAGGTATTATATGGGTGGAAACTCGAGTTTCCACCCATATAATACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011767.1-1137s1c1
Sequence:CCGGCCGCATTGAAAGCCTCTCAAACTCGAGTTTGAGAGGCTTTCAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011767.1-2540s1c1
Sequence:CCGGCTACCCAAACAGCTTGCTGTTCTCGAGAACAGCAAGCTGTTTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011767.1-3164s1c1
Sequence:CCGGCCACAAATGAATCAGCGCTTTCTCGAGAAAGCGCTGATTCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011767.1-2252s1c1
Sequence:CCGGGCAACTATTTATCCAACTGAACTCGAGTTCAGTTGGATAAATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks