EMAIL THIS PAGE TO A FRIEND

ZFX

zinc finger protein, X-linked

Synonyms: ZNF926
UniProtKB ID: P17010, O43668, Q8WYJ8
Gene ID:
Human(7543) Summary: This gene on the X chromosome is structurally similar to a related gene on the Y chromosome. It encodes a member of the krueppel C2H2-type zinc-finger protein family. The full-length protein contains an acidic transcriptional activation domain (AD), a nuclear localization sequence (NLS) and a DNA binding domain (DBD) consisting of 13 C2H2-type zinc fingers. Studies in mouse embryonic and adult hematopoietic stem cells showed that this gene was required as a transcriptional regulator for self-renewal of both stem cell types, but it was dispensable for growth and differentiation of their progeny. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2010]
Mouse(22764) zinc finger protein X-linked
Rat(367832) zinc finger protein X-linked
Zebrafish(560346) zinc finger protein, X-linked
chicken(418596) zinc finger protein, X-linked
dog(491778) zinc finger protein, X-linked
domestic cat(101094907) zinc finger protein, X-linked
domestic guinea pig(100716901) zinc finger protein, X-linked
naked mole-rat(101698255) zinc finger protein, X-linked
Domestic Rabbit(100350200) zinc finger protein, X-linked
cow(280961) zinc finger protein, X-linked
sheep(101114932) zinc finger protein, X-linked
246 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003410 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149261 MISSION® esiRNA esiRNA human ZFX (esiRNA2) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003410 Rosetta Predictions human pricing
NM_001109017 Rosetta Predictions rat pricing
NM_001044386 Rosetta Predictions mouse pricing
NM_011768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164864 predicted 2190
2 SASI_Hs01_00164865 predicted 764
3 SASI_Hs01_00164866 predicted 867
4 SASI_Hs01_00164867 predicted 2431
5 SASI_Hs01_00164868 predicted 958
6 SASI_Hs01_00164869 predicted 2548
7 SASI_Hs01_00164870 predicted 696
8 SASI_Hs01_00164871 predicted 502
9 SASI_Hs01_00164872 predicted 934
10 SASI_Hs01_00164873 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244354 predicted 1705
2 SASI_Rn02_00244355 predicted 1029
3 SASI_Rn02_00244356 predicted 562
4 SASI_Rn02_00244357 predicted 1139
5 SASI_Rn02_00244358 predicted 1380
6 SASI_Rn02_00244359 predicted 1691
7 SASI_Rn02_00244360 predicted 1283
8 SASI_Rn02_00244361 predicted 572
9 SASI_Rn02_00244362 predicted 1064
10 SASI_Rn02_00244363 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291274 predicted 1110
2 SASI_Mm02_00291275 predicted 1102
3 SASI_Mm02_00291276 predicted 829
4 SASI_Mm02_00291277 predicted 1126
5 SASI_Mm02_00291278 predicted 2159
6 SASI_Mm02_00291279 predicted 1201
7 SASI_Mm02_00291280 predicted 2154
8 SASI_Mm02_00291281 predicted 1065
9 SASI_Mm02_00291282 predicted 1090
10 SASI_Mm02_00291283 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321393 predicted 1040
2 SASI_Mm02_00321394 predicted 1036
3 SASI_Mm02_00321395 predicted 758
4 SASI_Mm01_00157304 predicted 1056
5 SASI_Mm02_00321396 predicted 2086
6 SASI_Mm02_00321397 predicted 1130
7 SASI_Mm02_00321398 predicted 2084
8 SASI_Mm02_00321399 predicted 997
9 SASI_Mm02_00321400 predicted 1029
10 SASI_Mm02_00321401 predicted 1071
11 SASI_Mm01_00157300 predicted 348
12 SASI_Mm01_00157301 predicted 2236
13 SASI_Mm01_00157302 predicted 396
14 SASI_Mm01_00157303 predicted 2376
15 SASI_Mm01_00157305 predicted 578
16 SASI_Mm01_00157306 predicted 333
17 SASI_Mm01_00157307 predicted 223
18 SASI_Mm01_00157308 predicted 1887
19 SASI_Mm01_00157309 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003410
VALIDATED
ZFX MISSION shRNA Bacterial Glycerol Stock
zinc finger protein, X-linked
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003410.2-2661s21c1
Sequence:CCGGAGTTGGCCTGCCCTAACAATACTCGAGTATTGTTAGGGCAGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003410.2-651s21c1
Sequence:CCGGACACGTCTTGACGGGTGATTCCTCGAGGAATCACCCGTCAAGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003410.2-456s21c1
Sequence:GTACCGGTGTTATTGAGGACGTTGTTATCTCGAGATAACAACGTCCTCAATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003410.2-3136s21c1
Sequence:CCGGAGTCAGGTCTAATTATCATAACTCGAGTTATGATAATTAGACCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003410.1-2194s1c1
Sequence:CCGGAGTGATTTGAAACGACACATACTCGAGTATGTGTCGTTTCAAATCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003410.1-858s1c1
Sequence:CCGGGCAGGATGATGACAAAGGCAACTCGAGTTGCCTTTGTCATCATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003410.1-466s1c1
Sequence:CCGGGACGTTGTTATAGAAGATGTTCTCGAGAACATCTTCTATAACAACGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003410.1-963s1c1
Sequence:CCGGGTCGGAAATTGATCCTTGTAACTCGAGTTACAAGGATCAATTTCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_003410.1-2738s1c1
Sequence:CCGGCCAATCAGTCTCATTCACATACTCGAGTATGTGAATGAGACTGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003410
VALIDATED
ZFX MISSION shRNA shRNA Plasmid DNA
zinc finger protein, X-linked
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003410.2-2661s21c1
Sequence:CCGGAGTTGGCCTGCCCTAACAATACTCGAGTATTGTTAGGGCAGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003410.2-651s21c1
Sequence:CCGGACACGTCTTGACGGGTGATTCCTCGAGGAATCACCCGTCAAGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003410.2-456s21c1
Sequence:GTACCGGTGTTATTGAGGACGTTGTTATCTCGAGATAACAACGTCCTCAATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003410.2-3136s21c1
Sequence:CCGGAGTCAGGTCTAATTATCATAACTCGAGTTATGATAATTAGACCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003410.1-2194s1c1
Sequence:CCGGAGTGATTTGAAACGACACATACTCGAGTATGTGTCGTTTCAAATCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003410.1-858s1c1
Sequence:CCGGGCAGGATGATGACAAAGGCAACTCGAGTTGCCTTTGTCATCATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003410.1-466s1c1
Sequence:CCGGGACGTTGTTATAGAAGATGTTCTCGAGAACATCTTCTATAACAACGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003410.1-963s1c1
Sequence:CCGGGTCGGAAATTGATCCTTGTAACTCGAGTTACAAGGATCAATTTCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_003410.1-2738s1c1
Sequence:CCGGCCAATCAGTCTCATTCACATACTCGAGTATGTGAATGAGACTGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003410
VALIDATED
ZFX MISSION shRNA Lentiviral Transduction Particles
zinc finger protein, X-linked
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003410.2-2661s21c1
Sequence:CCGGAGTTGGCCTGCCCTAACAATACTCGAGTATTGTTAGGGCAGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003410.2-651s21c1
Sequence:CCGGACACGTCTTGACGGGTGATTCCTCGAGGAATCACCCGTCAAGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003410.2-456s21c1
Sequence:GTACCGGTGTTATTGAGGACGTTGTTATCTCGAGATAACAACGTCCTCAATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003410.2-3136s21c1
Sequence:CCGGAGTCAGGTCTAATTATCATAACTCGAGTTATGATAATTAGACCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003410.1-2194s1c1
Sequence:CCGGAGTGATTTGAAACGACACATACTCGAGTATGTGTCGTTTCAAATCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003410.1-858s1c1
Sequence:CCGGGCAGGATGATGACAAAGGCAACTCGAGTTGCCTTTGTCATCATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003410.1-466s1c1
Sequence:CCGGGACGTTGTTATAGAAGATGTTCTCGAGAACATCTTCTATAACAACGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003410.1-963s1c1
Sequence:CCGGGTCGGAAATTGATCCTTGTAACTCGAGTTACAAGGATCAATTTCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_003410.1-2738s1c1
Sequence:CCGGCCAATCAGTCTCATTCACATACTCGAGTATGTGAATGAGACTGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011768
ZFX MISSION shRNA Bacterial Glycerol Stock
zinc finger protein, X-linked
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011768.1-6652s1c1
Sequence:CCGGGCCCAGAGTTAATAAAGTAATCTCGAGATTACTTTATTAACTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011768.1-869s1c1
Sequence:CCGGGACTGACTATGGACAACGAAACTCGAGTTTCGTTGTCCATAGTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011768.1-1895s1c1
Sequence:CCGGGCCTATTGAATCGCCATCTTTCTCGAGAAAGATGGCGATTCAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011768.1-889s1c1
Sequence:CCGGACAGAAATTGACCCTTGTAAACTCGAGTTTACAAGGGTCAATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011768.1-1272s1c1
Sequence:CCGGCGGTAATAATTCTGATGGAATCTCGAGATTCCATCAGAATTATTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011768
ZFX MISSION shRNA shRNA Plasmid DNA
zinc finger protein, X-linked
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011768.1-6652s1c1
Sequence:CCGGGCCCAGAGTTAATAAAGTAATCTCGAGATTACTTTATTAACTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011768.1-869s1c1
Sequence:CCGGGACTGACTATGGACAACGAAACTCGAGTTTCGTTGTCCATAGTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011768.1-1895s1c1
Sequence:CCGGGCCTATTGAATCGCCATCTTTCTCGAGAAAGATGGCGATTCAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011768.1-889s1c1
Sequence:CCGGACAGAAATTGACCCTTGTAAACTCGAGTTTACAAGGGTCAATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011768.1-1272s1c1
Sequence:CCGGCGGTAATAATTCTGATGGAATCTCGAGATTCCATCAGAATTATTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011768
ZFX MISSION shRNA Lentiviral Transduction Particles
zinc finger protein, X-linked
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011768.1-6652s1c1
Sequence:CCGGGCCCAGAGTTAATAAAGTAATCTCGAGATTACTTTATTAACTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011768.1-869s1c1
Sequence:CCGGGACTGACTATGGACAACGAAACTCGAGTTTCGTTGTCCATAGTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011768.1-1895s1c1
Sequence:CCGGGCCTATTGAATCGCCATCTTTCTCGAGAAAGATGGCGATTCAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011768.1-889s1c1
Sequence:CCGGACAGAAATTGACCCTTGTAAACTCGAGTTTACAAGGGTCAATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011768.1-1272s1c1
Sequence:CCGGCGGTAATAATTCTGATGGAATCTCGAGATTCCATCAGAATTATTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks