EMAIL THIS PAGE TO A FRIEND

ZFY

zinc finger protein, Y-linked

Synonyms: ZNF911
Species: Human ZFY(7544), cow ZFY(280962)
Gene ID:
Human(7544) Summary: This gene encodes a zinc finger-containing protein that may function as a transcription factor. This gene was once a candidate gene for the testis-determining factor (TDF) and was erroneously referred to as TDF. [provided by RefSeq, Jul 2008]
cow(280962) zinc finger protein, Y-linked
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003411 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003411 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111884 predicted 972
2 SASI_Hs01_00111885 predicted 676
3 SASI_Hs01_00111886 predicted 2212
4 SASI_Hs01_00111887 predicted 2770
5 SASI_Hs01_00111888 predicted 2660
6 SASI_Hs01_00111889 predicted 2229
7 SASI_Hs01_00111890 predicted 524
8 SASI_Hs01_00111891 predicted 2258
9 SASI_Hs01_00111892 predicted 1220
10 SASI_Hs01_00111893 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003411
VALIDATED
ZFY MISSION shRNA Bacterial Glycerol Stock
zinc finger protein, Y-linked
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003411.2-771s1c1
Sequence:CCGGGCAGAAATCATTACTGATCCTCTCGAGAGGATCAGTAATGATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003411.2-1185s1c1
Sequence:CCGGACTGTCAATGACTCTCAACAACTCGAGTTGTTGAGAGTCATTGACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003411.2-3097s1c1
Sequence:CCGGGCTAATATAAATGGGAGGTTTCTCGAGAAACCTCCCATTTATATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003411.2-2258s1c1
Sequence:CCGGCTATCCTCATAAGTGTGAGATCTCGAGATCTCACACTTATGAGGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003411.2-1302s1c1
Sequence:CCGGGCTGTGCATGAGCAGCAAATTCTCGAGAATTTGCTGCTCATGCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003411
VALIDATED
ZFY MISSION shRNA shRNA Plasmid DNA
zinc finger protein, Y-linked
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003411.2-771s1c1
Sequence:CCGGGCAGAAATCATTACTGATCCTCTCGAGAGGATCAGTAATGATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003411.2-1185s1c1
Sequence:CCGGACTGTCAATGACTCTCAACAACTCGAGTTGTTGAGAGTCATTGACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003411.2-3097s1c1
Sequence:CCGGGCTAATATAAATGGGAGGTTTCTCGAGAAACCTCCCATTTATATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003411.2-2258s1c1
Sequence:CCGGCTATCCTCATAAGTGTGAGATCTCGAGATCTCACACTTATGAGGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003411.2-1302s1c1
Sequence:CCGGGCTGTGCATGAGCAGCAAATTCTCGAGAATTTGCTGCTCATGCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003411
VALIDATED
ZFY MISSION shRNA Lentiviral Transduction Particles
zinc finger protein, Y-linked
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003411.2-771s1c1
Sequence:CCGGGCAGAAATCATTACTGATCCTCTCGAGAGGATCAGTAATGATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003411.2-1185s1c1
Sequence:CCGGACTGTCAATGACTCTCAACAACTCGAGTTGTTGAGAGTCATTGACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003411.2-3097s1c1
Sequence:CCGGGCTAATATAAATGGGAGGTTTCTCGAGAAACCTCCCATTTATATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003411.2-2258s1c1
Sequence:CCGGCTATCCTCATAAGTGTGAGATCTCGAGATCTCACACTTATGAGGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003411.2-1302s1c1
Sequence:CCGGGCTGTGCATGAGCAGCAAATTCTCGAGAATTTGCTGCTCATGCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks