EMAIL THIS PAGE TO A FRIEND

ZFYVE16

zinc finger, FYVE domain containing 16

Synonyms: ENDOFIN PPP1R69
Gene ID:
Human(9765) Summary: The ZFYVE16 gene encodes endofin, an endosomal protein implicated in regulating membrane trafficking. It is characterized by the presence of a phosphatidylinositol 3-phosphate-binding FYVE domain positioned in the middle of the molecule (Seet et al., 2004 [PubMed 14613930]
Mouse(218441) zinc finger, FYVE domain containing 16
Rat(499508) zinc finger, FYVE domain containing 16
Zebrafish(794689) zinc finger, FYVE domain containing 16
chicken(427315) zinc finger, FYVE domain containing 16
dog(479167) zinc finger, FYVE domain containing 16
Horse(100065363) zinc finger, FYVE domain containing 16
domestic cat(101087448) zinc finger, FYVE domain containing 16
domestic guinea pig(100730594) zinc finger, FYVE domain containing 16
naked mole-rat(101697568) zinc finger, FYVE domain containing 16
cow(536671) zinc finger, FYVE domain containing 16
sheep(101120662) zinc finger, FYVE domain containing 16
180 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014733 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105251 Rosetta Predictions human pricing
NM_014733 Rosetta Predictions human pricing
XM_001058708 Rosetta Predictions rat pricing
XM_574833 Rosetta Predictions rat pricing
NM_173392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324094 predicted 4971
2 SASI_Hs02_00324095 predicted 3900
3 SASI_Hs02_00324096 predicted 1929
4 SASI_Hs02_00324097 predicted 3171
5 SASI_Hs02_00324098 predicted 3626
6 SASI_Hs02_00324099 predicted 4006
7 SASI_Hs02_00324100 predicted 4933
8 SASI_Hs02_00324101 predicted 1149
9 SASI_Hs02_00324102 predicted 1713
10 SASI_Hs02_00324103 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117025 predicted 4842
2 SASI_Hs01_00117026 predicted 3774
3 SASI_Hs01_00117028 predicted 1803
4 SASI_Hs02_00346177 predicted 3040
5 SASI_Hs02_00346178 predicted 3497
6 SASI_Hs01_00117029 predicted 3871
7 SASI_Hs01_00117030 predicted 4799
8 SASI_Hs01_00117031 predicted 1026
9 SASI_Hs01_00117032 predicted 1590
10 SASI_Hs02_00346179 predicted 504
11 SASI_Hs01_00117027 predicted 2514
12 SASI_Hs01_00117033 predicted 2582
13 SASI_Hs01_00117034 predicted 3800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290618 predicted 4419
2 SASI_Rn02_00290619 predicted 2808
3 SASI_Rn02_00290620 predicted 3723
4 SASI_Rn02_00290621 predicted 3624
5 SASI_Rn02_00290622 predicted 3367
6 SASI_Rn02_00290623 predicted 2533
7 SASI_Rn02_00290624 predicted 729
8 SASI_Rn02_00290625 predicted 625
9 SASI_Rn02_00290626 predicted 1778
10 SASI_Rn02_00290627 predicted 2012
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574833 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402677 predicted 4412
2 SASI_Rn02_00402678 predicted 2804
3 SASI_Rn02_00402679 predicted 3725
4 SASI_Rn02_00402680 predicted 3627
5 SASI_Rn02_00402681 predicted 3360
6 SASI_Rn02_00402682 predicted 2534
7 SASI_Rn02_00402683 predicted 732
8 SASI_Rn02_00402684 predicted 618
9 SASI_Rn02_00402685 predicted 1776
10 SASI_Rn02_00402686 predicted 2014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150836 predicted 1671
2 SASI_Mm02_00345226 predicted 619
3 SASI_Mm01_00150837 predicted 1470
4 SASI_Mm01_00150838 predicted 2213
5 SASI_Mm01_00150839 predicted 4471
6 SASI_Mm01_00150840 predicted 1497
7 SASI_Mm01_00150841 predicted 1423
8 SASI_Mm01_00150842 predicted 394
9 SASI_Mm02_00345227 predicted 2495
10 SASI_Mm01_00150843 predicted 1278
11 SASI_Mm01_00150835 predicted 3820
12 SASI_Mm01_00150844 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173392
VALIDATED
ZFYVE16 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 16
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-3285s1c1
Sequence:CCGGCCTGCTACATTTGTTCTAAATCTCGAGATTTAGAACAAATGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-433s1c1
Sequence:CCGGCGGGACTTGATCTTCTTTCTTCTCGAGAAGAAAGAAGATCAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-1678s1c1
Sequence:CCGGGCATGAGAAGTGGCATACTAACTCGAGTTAGTATGCCACTTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-3569s1c1
Sequence:CCGGCCTGTTTATTACACCTACCTTCTCGAGAAGGTAGGTGTAATAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-1994s1c1
Sequence:CCGGGCCTGACATAAGGGATGAATTCTCGAGAATTCATCCCTTATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173392.4-1680s21c1
Sequence:CCGGGCATGAGAAGTGGCATACTAACTCGAGTTAGTATGCCACTTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173392.4-435s21c1
Sequence:CCGGCGGGACTTGATCTTCTTTCTTCTCGAGAAGAAAGAAGATCAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173392.4-3287s21c1
Sequence:CCGGCCTGCTACATTTGTTCTAAATCTCGAGATTTAGAACAAATGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173392.4-1996s21c1
Sequence:CCGGGCCTGACATAAGGGATGAATTCTCGAGAATTCATCCCTTATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173392
VALIDATED
ZFYVE16 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 16
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-3285s1c1
Sequence:CCGGCCTGCTACATTTGTTCTAAATCTCGAGATTTAGAACAAATGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-433s1c1
Sequence:CCGGCGGGACTTGATCTTCTTTCTTCTCGAGAAGAAAGAAGATCAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-1678s1c1
Sequence:CCGGGCATGAGAAGTGGCATACTAACTCGAGTTAGTATGCCACTTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-3569s1c1
Sequence:CCGGCCTGTTTATTACACCTACCTTCTCGAGAAGGTAGGTGTAATAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-1994s1c1
Sequence:CCGGGCCTGACATAAGGGATGAATTCTCGAGAATTCATCCCTTATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173392.4-1680s21c1
Sequence:CCGGGCATGAGAAGTGGCATACTAACTCGAGTTAGTATGCCACTTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173392.4-435s21c1
Sequence:CCGGCGGGACTTGATCTTCTTTCTTCTCGAGAAGAAAGAAGATCAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173392.4-3287s21c1
Sequence:CCGGCCTGCTACATTTGTTCTAAATCTCGAGATTTAGAACAAATGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173392.4-1996s21c1
Sequence:CCGGGCCTGACATAAGGGATGAATTCTCGAGAATTCATCCCTTATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173392
VALIDATED
ZFYVE16 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 16
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-3285s1c1
Sequence:CCGGCCTGCTACATTTGTTCTAAATCTCGAGATTTAGAACAAATGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-433s1c1
Sequence:CCGGCGGGACTTGATCTTCTTTCTTCTCGAGAAGAAAGAAGATCAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-1678s1c1
Sequence:CCGGGCATGAGAAGTGGCATACTAACTCGAGTTAGTATGCCACTTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-3569s1c1
Sequence:CCGGCCTGTTTATTACACCTACCTTCTCGAGAAGGTAGGTGTAATAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173392.1-1994s1c1
Sequence:CCGGGCCTGACATAAGGGATGAATTCTCGAGAATTCATCCCTTATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173392.4-1680s21c1
Sequence:CCGGGCATGAGAAGTGGCATACTAACTCGAGTTAGTATGCCACTTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173392.4-435s21c1
Sequence:CCGGCGGGACTTGATCTTCTTTCTTCTCGAGAAGAAAGAAGATCAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173392.4-3287s21c1
Sequence:CCGGCCTGCTACATTTGTTCTAAATCTCGAGATTTAGAACAAATGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173392.4-1996s21c1
Sequence:CCGGGCCTGACATAAGGGATGAATTCTCGAGAATTCATCCCTTATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014733
VALIDATED
ZFYVE16 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014733.2-4263s1c1
Sequence:CCGGCCTGAGAGAATACGTGGATATCTCGAGATATCCACGTATTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014733.2-929s1c1
Sequence:CCGGGCCAGCCATGTGGATTACTAACTCGAGTTAGTAATCCACATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014733.2-2143s1c1
Sequence:CCGGCCAGATACAATAGAAAGTGAACTCGAGTTCACTTTCTATTGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014733.2-3304s1c1
Sequence:CCGGCCTGTTACATTTGTCCTAAATCTCGAGATTTAGGACAAATGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014733.3-5251s21c1
Sequence:CCGGTTTGAGGTCTTAGACTTATAACTCGAGTTATAAGTCTAAGACCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014733.3-4305s21c1
Sequence:CCGGCCTGAGAGAATACGTGGATATCTCGAGATATCCACGTATTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014733.3-508s21c1
Sequence:CCGGGATGAAATCCAGCCGTTATATCTCGAGATATAACGGCTGGATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014733.3-3858s21c1
Sequence:CCGGACTTGTTGACCTTCGAAATTACTCGAGTAATTTCGAAGGTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014733.3-5089s21c1
Sequence:CCGGAGTATCTGCACTTAGGTATACCTCGAGGTATACCTAAGTGCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014733.3-1319s21c1
Sequence:CCGGGGTCTATGTGTGGATCATTAACTCGAGTTAATGATCCACACATAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014733
VALIDATED
ZFYVE16 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014733.2-4263s1c1
Sequence:CCGGCCTGAGAGAATACGTGGATATCTCGAGATATCCACGTATTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014733.2-929s1c1
Sequence:CCGGGCCAGCCATGTGGATTACTAACTCGAGTTAGTAATCCACATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014733.2-2143s1c1
Sequence:CCGGCCAGATACAATAGAAAGTGAACTCGAGTTCACTTTCTATTGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014733.2-3304s1c1
Sequence:CCGGCCTGTTACATTTGTCCTAAATCTCGAGATTTAGGACAAATGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014733.3-5251s21c1
Sequence:CCGGTTTGAGGTCTTAGACTTATAACTCGAGTTATAAGTCTAAGACCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014733.3-4305s21c1
Sequence:CCGGCCTGAGAGAATACGTGGATATCTCGAGATATCCACGTATTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014733.3-508s21c1
Sequence:CCGGGATGAAATCCAGCCGTTATATCTCGAGATATAACGGCTGGATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014733.3-3858s21c1
Sequence:CCGGACTTGTTGACCTTCGAAATTACTCGAGTAATTTCGAAGGTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014733.3-5089s21c1
Sequence:CCGGAGTATCTGCACTTAGGTATACCTCGAGGTATACCTAAGTGCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014733.3-1319s21c1
Sequence:CCGGGGTCTATGTGTGGATCATTAACTCGAGTTAATGATCCACACATAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014733
VALIDATED
ZFYVE16 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014733.2-4263s1c1
Sequence:CCGGCCTGAGAGAATACGTGGATATCTCGAGATATCCACGTATTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014733.2-929s1c1
Sequence:CCGGGCCAGCCATGTGGATTACTAACTCGAGTTAGTAATCCACATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014733.2-2143s1c1
Sequence:CCGGCCAGATACAATAGAAAGTGAACTCGAGTTCACTTTCTATTGTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014733.2-3304s1c1
Sequence:CCGGCCTGTTACATTTGTCCTAAATCTCGAGATTTAGGACAAATGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014733.3-5251s21c1
Sequence:CCGGTTTGAGGTCTTAGACTTATAACTCGAGTTATAAGTCTAAGACCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014733.3-4305s21c1
Sequence:CCGGCCTGAGAGAATACGTGGATATCTCGAGATATCCACGTATTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014733.3-508s21c1
Sequence:CCGGGATGAAATCCAGCCGTTATATCTCGAGATATAACGGCTGGATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014733.3-3858s21c1
Sequence:CCGGACTTGTTGACCTTCGAAATTACTCGAGTAATTTCGAAGGTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014733.3-5089s21c1
Sequence:CCGGAGTATCTGCACTTAGGTATACCTCGAGGTATACCTAAGTGCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014733.3-1319s21c1
Sequence:CCGGGGTCTATGTGTGGATCATTAACTCGAGTTAATGATCCACACATAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks