EMAIL THIS PAGE TO A FRIEND

ZFYVE19

zinc finger, FYVE domain containing 19

Synonyms: MPFYVE
UniProtKB ID: Q96K21, B3KVB2, C9JNF4, H3BUF9, Q86WC2, Q8WU96
Gene ID:
Mouse(72008) zinc finger, FYVE domain containing 19
Rat(499871) zinc finger, FYVE domain containing 19
cow(511054) zinc finger, FYVE domain containing 19
sheep(101109973) zinc finger, FYVE domain containing 19
naked mole-rat(101718629) zinc finger, FYVE domain containing 19
domestic guinea pig(100717676) zinc finger, FYVE domain containing 19
Zebrafish(436685) zinc finger, FYVE domain containing 19
domestic cat(101085894) zinc finger, FYVE domain containing 19
dog(487499) zinc finger, FYVE domain containing 19
chicken(423204) zinc finger, FYVE domain containing 19
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032850 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077268 Rosetta Predictions human pricing
NM_032850 Rosetta Predictions human pricing
NM_001034948 Rosetta Predictions rat pricing
NM_028054 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312344 predicted 2009
2 SASI_Hs02_00312345 predicted 1985
3 SASI_Hs02_00312346 predicted 1975
4 SASI_Hs02_00312347 predicted 1859
5 SASI_Hs02_00312348 predicted 1532
6 SASI_Hs02_00312349 predicted 1442
7 SASI_Hs02_00312350 predicted 898
8 SASI_Hs02_00312351 predicted 1639
9 SASI_Hs02_00312352 predicted 1174
10 SASI_Hs02_00312353 predicted 1294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168780 predicted 300
2 SASI_Hs01_00168781 predicted 1511
3 SASI_Hs01_00168782 predicted 261
4 SASI_Hs01_00168783 predicted 1050
5 SASI_Hs01_00168784 predicted 418
6 SASI_Hs01_00168785 predicted 262
7 SASI_Hs01_00168786 predicted 233
8 SASI_Hs01_00168787 predicted 699
9 SASI_Hs01_00168788 predicted 940
10 SASI_Hs01_00168789 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034948 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121375 predicted 1335
2 SASI_Rn02_00204135 predicted 201
3 SASI_Rn01_00121377 predicted 575
4 SASI_Rn01_00121378 predicted 1172
5 SASI_Rn01_00121379 predicted 829
6 SASI_Rn01_00121380 predicted 223
7 SASI_Rn01_00121381 predicted 610
8 SASI_Rn01_00121382 predicted 876
9 SASI_Rn01_00121383 predicted 427
10 SASI_Rn01_00121384 predicted 250
11 SASI_Rn01_00121376 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166134 predicted 783
2 SASI_Mm02_00333247 predicted 1263
3 SASI_Mm01_00166135 predicted 1087
4 SASI_Mm01_00166136 predicted 1331
5 SASI_Mm01_00166137 predicted 303
6 SASI_Mm01_00166138 predicted 1088
7 SASI_Mm01_00166139 predicted 1089
8 SASI_Mm01_00166140 predicted 749
9 SASI_Mm01_00166141 predicted 246
10 SASI_Mm01_00166142 predicted 1333
11 SASI_Mm01_00166143 predicted 1327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028054
VALIDATED
ZFYVE19 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 19
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028054.2-1491s21c1
Sequence:CCGGCTGGAAGGAAGAAACATAATACTCGAGTATTATGTTTCTTCCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028054.2-376s21c1
Sequence:CCGGGGTCACCACCTCAGAACTATACTCGAGTATAGTTCTGAGGTGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028054.2-224s21c1
Sequence:CCGGGGAGTATGGCTGTAAGAATTGCTCGAGCAATTCTTACAGCCATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028054.2-1271s21c1
Sequence:CCGGCCATGATAACTTTGATCTTAACTCGAGTTAAGATCAAAGTTATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028054.2-1197s21c1
Sequence:CCGGTGCAATGAGGATGCTACTTTGCTCGAGCAAAGTAGCATCCTCATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028054.1-1193s1c1
Sequence:CCGGGTATCTGCAATGAGGATGCTACTCGAGTAGCATCCTCATTGCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028054.1-219s1c1
Sequence:CCGGCAAGAAGGAGTATGGCTGTAACTCGAGTTACAGCCATACTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028054.1-1267s1c1
Sequence:CCGGGAGGGCCATGATAACTTTGATCTCGAGATCAAAGTTATCATGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028054
VALIDATED
ZFYVE19 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 19
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028054.2-1491s21c1
Sequence:CCGGCTGGAAGGAAGAAACATAATACTCGAGTATTATGTTTCTTCCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028054.2-376s21c1
Sequence:CCGGGGTCACCACCTCAGAACTATACTCGAGTATAGTTCTGAGGTGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028054.2-224s21c1
Sequence:CCGGGGAGTATGGCTGTAAGAATTGCTCGAGCAATTCTTACAGCCATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028054.2-1271s21c1
Sequence:CCGGCCATGATAACTTTGATCTTAACTCGAGTTAAGATCAAAGTTATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028054.2-1197s21c1
Sequence:CCGGTGCAATGAGGATGCTACTTTGCTCGAGCAAAGTAGCATCCTCATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028054.1-1193s1c1
Sequence:CCGGGTATCTGCAATGAGGATGCTACTCGAGTAGCATCCTCATTGCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028054.1-219s1c1
Sequence:CCGGCAAGAAGGAGTATGGCTGTAACTCGAGTTACAGCCATACTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028054.1-1267s1c1
Sequence:CCGGGAGGGCCATGATAACTTTGATCTCGAGATCAAAGTTATCATGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028054
VALIDATED
ZFYVE19 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 19
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028054.2-1491s21c1
Sequence:CCGGCTGGAAGGAAGAAACATAATACTCGAGTATTATGTTTCTTCCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028054.2-376s21c1
Sequence:CCGGGGTCACCACCTCAGAACTATACTCGAGTATAGTTCTGAGGTGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028054.2-224s21c1
Sequence:CCGGGGAGTATGGCTGTAAGAATTGCTCGAGCAATTCTTACAGCCATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028054.2-1271s21c1
Sequence:CCGGCCATGATAACTTTGATCTTAACTCGAGTTAAGATCAAAGTTATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028054.2-1197s21c1
Sequence:CCGGTGCAATGAGGATGCTACTTTGCTCGAGCAAAGTAGCATCCTCATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028054.1-1193s1c1
Sequence:CCGGGTATCTGCAATGAGGATGCTACTCGAGTAGCATCCTCATTGCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028054.1-219s1c1
Sequence:CCGGCAAGAAGGAGTATGGCTGTAACTCGAGTTACAGCCATACTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028054.1-1267s1c1
Sequence:CCGGGAGGGCCATGATAACTTTGATCTCGAGATCAAAGTTATCATGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032850
VALIDATED
ZFYVE19 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 19
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032850.3-1576s1c1
Sequence:CCGGGTCCCTGGAATGAGGAAAGATCTCGAGATCTTTCCTCATTCCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032850.3-535s1c1
Sequence:CCGGGACACGACAAGACCAGATGATCTCGAGATCATCTGGTCTTGTCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032850.3-536s1c1
Sequence:CCGGACACGACAAGACCAGATGATTCTCGAGAATCATCTGGTCTTGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032850.3-278s1c1
Sequence:CCGGCTGCCAGATTCCTCTGGTAAACTCGAGTTTACCAGAGGAATCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032850.3-818s1c1
Sequence:CCGGGCTATCGATGAAAGCTGGAAACTCGAGTTTCCAGCTTTCATCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032850
VALIDATED
ZFYVE19 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 19
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032850.3-1576s1c1
Sequence:CCGGGTCCCTGGAATGAGGAAAGATCTCGAGATCTTTCCTCATTCCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032850.3-535s1c1
Sequence:CCGGGACACGACAAGACCAGATGATCTCGAGATCATCTGGTCTTGTCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032850.3-536s1c1
Sequence:CCGGACACGACAAGACCAGATGATTCTCGAGAATCATCTGGTCTTGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032850.3-278s1c1
Sequence:CCGGCTGCCAGATTCCTCTGGTAAACTCGAGTTTACCAGAGGAATCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032850.3-818s1c1
Sequence:CCGGGCTATCGATGAAAGCTGGAAACTCGAGTTTCCAGCTTTCATCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032850
VALIDATED
ZFYVE19 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 19
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032850.3-1576s1c1
Sequence:CCGGGTCCCTGGAATGAGGAAAGATCTCGAGATCTTTCCTCATTCCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032850.3-535s1c1
Sequence:CCGGGACACGACAAGACCAGATGATCTCGAGATCATCTGGTCTTGTCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032850.3-536s1c1
Sequence:CCGGACACGACAAGACCAGATGATTCTCGAGAATCATCTGGTCTTGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032850.3-278s1c1
Sequence:CCGGCTGCCAGATTCCTCTGGTAAACTCGAGTTTACCAGAGGAATCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032850.3-818s1c1
Sequence:CCGGGCTATCGATGAAAGCTGGAAACTCGAGTTTCCAGCTTTCATCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks