EMAIL THIS PAGE TO A FRIEND

ZFYVE1

zinc finger, FYVE domain containing 1

Synonyms: DFCP1 SR3 TAFF1 ZNFN2A1
UniProtKB ID: Q9HBF4, Q8WYX7, Q96K57, Q9BXP9, Q9HCI3
Gene ID:
Human(53349) Summary: The FYVE domain mediates the recruitment of proteins involved in membrane trafficking and cell signaling to phosphatidylinositol 3-phosphate (PtdIns(3)P)-containing membranes. This gene encodes a protein which contains two zinc-binding FYVE domains in tandem. This protein displays a predominantly Golgi, endoplasmic reticulum and vesicular distribution. Alternatively spliced transcript variants have been found for this gene, and they encode two isoforms with different sizes. [provided by RefSeq, Jul 2008]
Mouse(217695) zinc finger, FYVE domain containing 1
Rat(299188) zinc finger, FYVE domain containing 1
cow(537916) zinc finger, FYVE domain containing 1
sheep(101123382) zinc finger, FYVE domain containing 1
Domestic Rabbit(100346566) zinc finger, FYVE domain containing 1
naked mole-rat(101717361) zinc finger, FYVE domain containing 1
domestic guinea pig(100727595) zinc finger, FYVE domain containing 1
Zebrafish(100005732) zinc finger, FYVE domain containing 1
Horse(100050098) zinc finger, FYVE domain containing 1
domestic cat(101086572) zinc finger, FYVE domain containing 1
chicken(423252) zinc finger, FYVE domain containing 1
dog(490768) zinc finger, FYVE domain containing 1
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021260 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183154 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183154 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183154 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021260 Rosetta Predictions human pricing
NM_178441 Rosetta Predictions human pricing
NM_001106743 Rosetta Predictions rat pricing
NM_183154 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116580 predicted 2169
2 SASI_Hs01_00116581 predicted 3184
3 SASI_Hs01_00116582 predicted 3240
4 SASI_Hs01_00116583 predicted 2730
5 SASI_Hs01_00116584 predicted 2450
6 SASI_Hs01_00116585 predicted 2039
7 SASI_Hs01_00116586 predicted 2824
8 SASI_Hs01_00116587 predicted 2163
9 SASI_Hs02_00354922 predicted 2155
10 SASI_Hs02_00354923 predicted 2619
11 SASI_Hs01_00116588 predicted 2467
12 SASI_Hs01_00116589 predicted 2175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050204 predicted 387
2 SASI_Hs01_00050205 predicted 1403
3 SASI_Hs01_00050206 predicted 1456
4 SASI_Hs01_00050207 predicted 950
5 SASI_Hs01_00050208 predicted 667
6 SASI_Hs01_00050209 predicted 266
7 SASI_Hs01_00050210 predicted 1046
8 SASI_Hs01_00050211 predicted 377
9 SASI_Hs02_00369671 predicted 370
10 SASI_Hs02_00369672 predicted 835
11 SASI_Hs01_00050212 predicted 688
12 SASI_Hs01_00050213 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221958 predicted 1759
2 SASI_Rn02_00221959 predicted 1853
3 SASI_Rn02_00221960 predicted 1040
4 SASI_Rn02_00221961 predicted 1908
5 SASI_Rn02_00221962 predicted 1582
6 SASI_Rn02_00221963 predicted 1031
7 SASI_Rn02_00221964 predicted 2253
8 SASI_Rn02_00221965 predicted 1704
9 SASI_Rn02_00221966 predicted 1406
10 SASI_Rn02_00221967 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104534 predicted 1109
2 SASI_Mm01_00104535 predicted 1673
3 SASI_Mm01_00104537 predicted 2279
4 SASI_Mm02_00350209 predicted 636
5 SASI_Mm01_00104539 predicted 1399
6 SASI_Mm02_00350210 predicted 777
7 SASI_Mm01_00104540 predicted 2561
8 SASI_Mm01_00104541 predicted 1259
9 SASI_Mm01_00104542 predicted 2281
10 SASI_Mm01_00104543 predicted 2162
11 SASI_Mm01_00104536 predicted 578
12 SASI_Mm01_00104538 predicted 2110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021260
ZFYVE1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021260.1-2029s1c1
Sequence:CCGGCCAGTATGACAACCGAGTGTACTCGAGTACACTCGGTTGTCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021260.1-2990s1c1
Sequence:CCGGCGAGTCCTTCACAATTCCTTACTCGAGTAAGGAATTGTGAAGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021260.1-1175s1c1
Sequence:CCGGCATCTGAAAGTGGTTTCCATTCTCGAGAATGGAAACCACTTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021260.1-3975s1c1
Sequence:CCGGGCACAGGATGAACTGTTAGTTCTCGAGAACTAACAGTTCATCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021260.1-2437s1c1
Sequence:CCGGCCAGATTCTGAGCTGCAACAACTCGAGTTGTTGCAGCTCAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021260.1-715s1c1
Sequence:CCGGCGGGACTGATGAAGCTATCTTCTCGAGAAGATAGCTTCATCAGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021260.1-1423s1c1
Sequence:CCGGCCTCGTCATCTATCGAACTCACTCGAGTGAGTTCGATAGATGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021260.1-4134s1c1
Sequence:CCGGCCCGTTGTGCTGAAATCCTATCTCGAGATAGGATTTCAGCACAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021260.1-2729s1c1
Sequence:CCGGGACATACCACTAGGTCTGGTACTCGAGTACCAGACCTAGTGGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021260
ZFYVE1 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021260.1-2029s1c1
Sequence:CCGGCCAGTATGACAACCGAGTGTACTCGAGTACACTCGGTTGTCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021260.1-2990s1c1
Sequence:CCGGCGAGTCCTTCACAATTCCTTACTCGAGTAAGGAATTGTGAAGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021260.1-1175s1c1
Sequence:CCGGCATCTGAAAGTGGTTTCCATTCTCGAGAATGGAAACCACTTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021260.1-3975s1c1
Sequence:CCGGGCACAGGATGAACTGTTAGTTCTCGAGAACTAACAGTTCATCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021260.1-2437s1c1
Sequence:CCGGCCAGATTCTGAGCTGCAACAACTCGAGTTGTTGCAGCTCAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021260.1-715s1c1
Sequence:CCGGCGGGACTGATGAAGCTATCTTCTCGAGAAGATAGCTTCATCAGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021260.1-1423s1c1
Sequence:CCGGCCTCGTCATCTATCGAACTCACTCGAGTGAGTTCGATAGATGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021260.1-4134s1c1
Sequence:CCGGCCCGTTGTGCTGAAATCCTATCTCGAGATAGGATTTCAGCACAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021260.1-2729s1c1
Sequence:CCGGGACATACCACTAGGTCTGGTACTCGAGTACCAGACCTAGTGGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021260
ZFYVE1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021260.1-2029s1c1
Sequence:CCGGCCAGTATGACAACCGAGTGTACTCGAGTACACTCGGTTGTCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021260.1-2990s1c1
Sequence:CCGGCGAGTCCTTCACAATTCCTTACTCGAGTAAGGAATTGTGAAGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021260.1-1175s1c1
Sequence:CCGGCATCTGAAAGTGGTTTCCATTCTCGAGAATGGAAACCACTTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021260.1-3975s1c1
Sequence:CCGGGCACAGGATGAACTGTTAGTTCTCGAGAACTAACAGTTCATCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021260.1-2437s1c1
Sequence:CCGGCCAGATTCTGAGCTGCAACAACTCGAGTTGTTGCAGCTCAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021260.1-715s1c1
Sequence:CCGGCGGGACTGATGAAGCTATCTTCTCGAGAAGATAGCTTCATCAGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021260.1-1423s1c1
Sequence:CCGGCCTCGTCATCTATCGAACTCACTCGAGTGAGTTCGATAGATGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021260.1-4134s1c1
Sequence:CCGGCCCGTTGTGCTGAAATCCTATCTCGAGATAGGATTTCAGCACAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021260.1-2729s1c1
Sequence:CCGGGACATACCACTAGGTCTGGTACTCGAGTACCAGACCTAGTGGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183154
VALIDATED
ZFYVE1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183154.1-2364s1c1
Sequence:CCGGCGACTGCTTCACAATTCCTTACTCGAGTAAGGAATTGTGAAGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183154.1-824s1c1
Sequence:CCGGCCGGCTGCATAATGACCTCTTCTCGAGAAGAGGTCATTATGCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183154.1-827s1c1
Sequence:CCGGGCTGCATAATGACCTCTTCAACTCGAGTTGAAGAGGTCATTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183154.1-1404s1c1
Sequence:CCGGCAGTATGACAACCGCGTCTATCTCGAGATAGACGCGGTTGTCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183154.1-486s1c1
Sequence:CCGGGAAGAGATCCAGGTAACAAATCTCGAGATTTGTTACCTGGATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183154
VALIDATED
ZFYVE1 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183154.1-2364s1c1
Sequence:CCGGCGACTGCTTCACAATTCCTTACTCGAGTAAGGAATTGTGAAGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183154.1-824s1c1
Sequence:CCGGCCGGCTGCATAATGACCTCTTCTCGAGAAGAGGTCATTATGCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183154.1-827s1c1
Sequence:CCGGGCTGCATAATGACCTCTTCAACTCGAGTTGAAGAGGTCATTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183154.1-1404s1c1
Sequence:CCGGCAGTATGACAACCGCGTCTATCTCGAGATAGACGCGGTTGTCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183154.1-486s1c1
Sequence:CCGGGAAGAGATCCAGGTAACAAATCTCGAGATTTGTTACCTGGATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183154
VALIDATED
ZFYVE1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183154.1-2364s1c1
Sequence:CCGGCGACTGCTTCACAATTCCTTACTCGAGTAAGGAATTGTGAAGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183154.1-824s1c1
Sequence:CCGGCCGGCTGCATAATGACCTCTTCTCGAGAAGAGGTCATTATGCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183154.1-827s1c1
Sequence:CCGGGCTGCATAATGACCTCTTCAACTCGAGTTGAAGAGGTCATTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183154.1-1404s1c1
Sequence:CCGGCAGTATGACAACCGCGTCTATCTCGAGATAGACGCGGTTGTCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183154.1-486s1c1
Sequence:CCGGGAAGAGATCCAGGTAACAAATCTCGAGATTTGTTACCTGGATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks