EMAIL THIS PAGE TO A FRIEND

ZFYVE20

zinc finger, FYVE domain containing 20

Synonyms: Rabenosyn-5
UniProtKB ID: Q9H1K0, Q3KP30, Q59EY8, Q8NAQ1
Gene ID:
Mouse(78287) zinc finger, FYVE domain containing 20
Rat(312562) zinc finger, FYVE domain containing 20
chicken(416128) zinc finger, FYVE domain containing 20
domestic cat(101099700) zinc finger, FYVE domain containing 20
Horse(100056078) zinc finger, FYVE domain containing 20
dog(484642) zinc finger, FYVE domain containing 20
domestic guinea pig(100717889) zinc finger, FYVE domain containing 20
naked mole-rat(101698864) zinc finger, FYVE domain containing 20
cow(511484) zinc finger, FYVE domain containing 20
sheep(101108345) zinc finger, FYVE domain containing 20
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022340 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000891 MISSION® esiRNA esiRNA targeting human ZFYVE20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022340 Rosetta Predictions human pricing
NM_001107875 Rosetta Predictions rat pricing
NM_030081 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226869 predicted 1480
2 SASI_Hs01_00226870 predicted 1726
3 SASI_Hs01_00226871 predicted 1599
4 SASI_Hs01_00226872 predicted 1602
5 SASI_Hs01_00226873 predicted 1577
6 SASI_Hs01_00226874 predicted 1015
7 SASI_Hs01_00226875 predicted 2849
8 SASI_Hs01_00226876 predicted 952
9 SASI_Hs01_00226877 predicted 1671
10 SASI_Hs01_00226878 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233145 predicted 671
2 SASI_Rn02_00233146 predicted 665
3 SASI_Rn02_00233147 predicted 1762
4 SASI_Rn02_00233148 predicted 1375
5 SASI_Rn02_00233149 predicted 1328
6 SASI_Rn02_00233150 predicted 870
7 SASI_Rn02_00233151 predicted 1297
8 SASI_Rn02_00233152 predicted 2171
9 SASI_Rn02_00233153 predicted 2185
10 SASI_Rn02_00233154 predicted 1193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336471 predicted 2500
2 SASI_Mm02_00336472 predicted 1916
3 SASI_Mm02_00336473 predicted 1255
4 SASI_Mm02_00336474 predicted 1133
5 SASI_Mm02_00336475 predicted 1192
6 SASI_Mm02_00336476 predicted 811
7 SASI_Mm02_00336477 predicted 2508
8 SASI_Mm02_00336478 predicted 1247
9 SASI_Mm02_00336479 predicted 1230
10 SASI_Mm02_00336480 predicted 1104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022340
ZFYVE20 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 20
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-1389s1c1
Sequence:CCGGCCACAACATCACATCATTCATCTCGAGATGAATGATGTGATGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-1971s1c1
Sequence:CCGGCCTGAAGGAGTACAATCCTTTCTCGAGAAAGGATTGTACTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022340.1-1978s1c1
Sequence:CCGGGAGTACAATCCTTTCGAGGAACTCGAGTTCCTCGAAAGGATTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022340.1-1765s1c1
Sequence:CCGGCCTTCACTTAGCTCAACTCAACTCGAGTTGAGTTGAGCTAAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022340.1-865s1c1
Sequence:CCGGGTTGACCAGAAAGCTCCAGAACTCGAGTTCTGGAGCTTTCTGGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-1650s1c1
Sequence:CCGGCTTCAGAGAAATCGGCCCTTTCTCGAGAAAGGGCCGATTTCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-424s1c1
Sequence:CCGGGCAAAGATTCGAGCAATAGAACTCGAGTTCTATTGCTCGAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022340.1-346s1c1
Sequence:CCGGCACTATGTTGTGGAAGTCAATCTCGAGATTGACTTCCACAACATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-837s1c1
Sequence:CCGGCGAGAAATTACGACTTTGCATCTCGAGATGCAAAGTCGTAATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022340
ZFYVE20 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 20
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-1389s1c1
Sequence:CCGGCCACAACATCACATCATTCATCTCGAGATGAATGATGTGATGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-1971s1c1
Sequence:CCGGCCTGAAGGAGTACAATCCTTTCTCGAGAAAGGATTGTACTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022340.1-1978s1c1
Sequence:CCGGGAGTACAATCCTTTCGAGGAACTCGAGTTCCTCGAAAGGATTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022340.1-1765s1c1
Sequence:CCGGCCTTCACTTAGCTCAACTCAACTCGAGTTGAGTTGAGCTAAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022340.1-865s1c1
Sequence:CCGGGTTGACCAGAAAGCTCCAGAACTCGAGTTCTGGAGCTTTCTGGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-1650s1c1
Sequence:CCGGCTTCAGAGAAATCGGCCCTTTCTCGAGAAAGGGCCGATTTCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-424s1c1
Sequence:CCGGGCAAAGATTCGAGCAATAGAACTCGAGTTCTATTGCTCGAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022340.1-346s1c1
Sequence:CCGGCACTATGTTGTGGAAGTCAATCTCGAGATTGACTTCCACAACATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-837s1c1
Sequence:CCGGCGAGAAATTACGACTTTGCATCTCGAGATGCAAAGTCGTAATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022340
ZFYVE20 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 20
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-1389s1c1
Sequence:CCGGCCACAACATCACATCATTCATCTCGAGATGAATGATGTGATGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-1971s1c1
Sequence:CCGGCCTGAAGGAGTACAATCCTTTCTCGAGAAAGGATTGTACTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022340.1-1978s1c1
Sequence:CCGGGAGTACAATCCTTTCGAGGAACTCGAGTTCCTCGAAAGGATTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022340.1-1765s1c1
Sequence:CCGGCCTTCACTTAGCTCAACTCAACTCGAGTTGAGTTGAGCTAAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022340.1-865s1c1
Sequence:CCGGGTTGACCAGAAAGCTCCAGAACTCGAGTTCTGGAGCTTTCTGGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-1650s1c1
Sequence:CCGGCTTCAGAGAAATCGGCCCTTTCTCGAGAAAGGGCCGATTTCTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-424s1c1
Sequence:CCGGGCAAAGATTCGAGCAATAGAACTCGAGTTCTATTGCTCGAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022340.1-346s1c1
Sequence:CCGGCACTATGTTGTGGAAGTCAATCTCGAGATTGACTTCCACAACATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022340.1-837s1c1
Sequence:CCGGCGAGAAATTACGACTTTGCATCTCGAGATGCAAAGTCGTAATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030081
VALIDATED
ZFYVE20 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-489s1c1
Sequence:CCGGGACCCAAGGATATGAATCATTCTCGAGAATGATTCATATCCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-1922s1c1
Sequence:CCGGGAGAAGTTATACCCTTCCAATCTCGAGATTGGAAGGGTATAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-1233s1c1
Sequence:CCGGGCAGAAAGTATATGAGCTAATCTCGAGATTAGCTCATATACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-598s1c1
Sequence:CCGGGCTGCAAGAATTGACCACTATCTCGAGATAGTGGTCAATTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-3132s1c1
Sequence:CCGGCCTCCCAGTTAAAGGAAGTAACTCGAGTTACTTCCTTTAACTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030081
VALIDATED
ZFYVE20 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-489s1c1
Sequence:CCGGGACCCAAGGATATGAATCATTCTCGAGAATGATTCATATCCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-1922s1c1
Sequence:CCGGGAGAAGTTATACCCTTCCAATCTCGAGATTGGAAGGGTATAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-1233s1c1
Sequence:CCGGGCAGAAAGTATATGAGCTAATCTCGAGATTAGCTCATATACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-598s1c1
Sequence:CCGGGCTGCAAGAATTGACCACTATCTCGAGATAGTGGTCAATTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-3132s1c1
Sequence:CCGGCCTCCCAGTTAAAGGAAGTAACTCGAGTTACTTCCTTTAACTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030081
VALIDATED
ZFYVE20 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-489s1c1
Sequence:CCGGGACCCAAGGATATGAATCATTCTCGAGAATGATTCATATCCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-1922s1c1
Sequence:CCGGGAGAAGTTATACCCTTCCAATCTCGAGATTGGAAGGGTATAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-1233s1c1
Sequence:CCGGGCAGAAAGTATATGAGCTAATCTCGAGATTAGCTCATATACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-598s1c1
Sequence:CCGGGCTGCAAGAATTGACCACTATCTCGAGATAGTGGTCAATTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030081.2-3132s1c1
Sequence:CCGGCCTCCCAGTTAAAGGAAGTAACTCGAGTTACTTCCTTTAACTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks