EMAIL THIS PAGE TO A FRIEND

ZFYVE21

zinc finger, FYVE domain containing 21

Synonyms: ZF21
UniProtKB ID: Q9BQ24, A8K3A4, Q86T05, Q96LT1
Gene ID:
Mouse(68520) zinc finger, FYVE domain containing 21
Rat(362789) zinc finger, FYVE domain containing 21
cow(511413) zinc finger, FYVE domain containing 21
naked mole-rat(101708351) zinc finger, FYVE domain containing 21
domestic guinea pig(100712706) zinc finger, FYVE domain containing 21
Zebrafish(100004144) zinc finger, FYVE domain containing 21
domestic cat(101099382) zinc finger, FYVE domain containing 21
chicken(423486) zinc finger, FYVE domain containing 21
dog(480447) zinc finger, FYVE domain containing 21
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024071 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024071 Rosetta Predictions human pricing
NM_001108725 Rosetta Predictions rat pricing
NM_026752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241376 predicted 1097
2 SASI_Hs01_00241379 predicted 922
3 SASI_Hs01_00241380 predicted 415
4 SASI_Hs01_00241381 predicted 878
5 SASI_Hs01_00241382 predicted 996
6 SASI_Hs01_00241383 predicted 855
7 SASI_Hs02_00356533 predicted 879
8 SASI_Hs01_00241385 predicted 865
9 SASI_Hs02_00356534 predicted 455
10 SASI_Hs02_00356535 predicted 877
11 SASI_Hs01_00241377 predicted 951
12 SASI_Hs01_00241378 predicted 1074
13 SASI_Hs01_00241384 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241465 predicted 588
2 SASI_Rn02_00241466 predicted 474
3 SASI_Rn02_00241467 predicted 727
4 SASI_Rn02_00241468 predicted 406
5 SASI_Rn02_00241469 predicted 727
6 SASI_Rn02_00241470 predicted 589
7 SASI_Rn02_00241471 predicted 373
8 SASI_Rn02_00241472 predicted 441
9 SASI_Rn02_00241473 predicted 470
10 SASI_Rn02_00241474 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027723 predicted 298
2 SASI_Mm02_00330800 predicted 423
3 SASI_Mm02_00330801 predicted 457
4 SASI_Mm02_00330802 predicted 361
5 SASI_Mm01_00027725 predicted 323
6 SASI_Mm02_00330803 predicted 322
7 SASI_Mm01_00027728 predicted 366
8 SASI_Mm02_00330804 predicted 641
9 SASI_Mm01_00027731 predicted 439
10 SASI_Mm02_00330805 predicted 352
11 SASI_Mm01_00027724 predicted 1010
12 SASI_Mm01_00027726 predicted 915
13 SASI_Mm01_00027727 predicted 923
14 SASI_Mm01_00027729 predicted 495
15 SASI_Mm01_00027730 predicted 948
16 SASI_Mm01_00027732 predicted 942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024071
VALIDATED
ZFYVE21 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 21
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024071.2-406s1c1
Sequence:CCGGCGTCACGTTTGGAAACTCAGACTCGAGTCTGAGTTTCCAAACGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024071.2-434s1c1
Sequence:CCGGGAAACTATGACTTGTCGTCTTCTCGAGAAGACGACAAGTCATAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024071.2-450s1c1
Sequence:CCGGGTCTTTCCAATAACCAGAGATCTCGAGATCTCTGGTTATTGGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024071.2-488s1c1
Sequence:CCGGGACAGCCACTATGAAATCGAACTCGAGTTCGATTTCATAGTGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024071.2-707s1c1
Sequence:CCGGGCCAAGCTCCTCTATGAATCTCTCGAGAGATTCATAGAGGAGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024071.2-192s21c1
Sequence:CCGGGTGACGCCAAGTTTGACTTTCCTCGAGGAAAGTCAAACTTGGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024071.2-813s21c1
Sequence:CCGGTTGCGTACCACAGGGATTAATCTCGAGATTAATCCCTGTGGTACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024071.2-580s21c1
Sequence:CCGGAGGCATGTTCCTGCAGTATACCTCGAGGTATACTGCAGGAACATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024071.2-1211s21c1
Sequence:CCGGCACTTACCTTGTCACTAATTTCTCGAGAAATTAGTGACAAGGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024071
VALIDATED
ZFYVE21 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 21
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024071.2-406s1c1
Sequence:CCGGCGTCACGTTTGGAAACTCAGACTCGAGTCTGAGTTTCCAAACGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024071.2-434s1c1
Sequence:CCGGGAAACTATGACTTGTCGTCTTCTCGAGAAGACGACAAGTCATAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024071.2-450s1c1
Sequence:CCGGGTCTTTCCAATAACCAGAGATCTCGAGATCTCTGGTTATTGGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024071.2-488s1c1
Sequence:CCGGGACAGCCACTATGAAATCGAACTCGAGTTCGATTTCATAGTGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024071.2-707s1c1
Sequence:CCGGGCCAAGCTCCTCTATGAATCTCTCGAGAGATTCATAGAGGAGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024071.2-192s21c1
Sequence:CCGGGTGACGCCAAGTTTGACTTTCCTCGAGGAAAGTCAAACTTGGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024071.2-813s21c1
Sequence:CCGGTTGCGTACCACAGGGATTAATCTCGAGATTAATCCCTGTGGTACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024071.2-580s21c1
Sequence:CCGGAGGCATGTTCCTGCAGTATACCTCGAGGTATACTGCAGGAACATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024071.2-1211s21c1
Sequence:CCGGCACTTACCTTGTCACTAATTTCTCGAGAAATTAGTGACAAGGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024071
VALIDATED
ZFYVE21 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 21
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024071.2-406s1c1
Sequence:CCGGCGTCACGTTTGGAAACTCAGACTCGAGTCTGAGTTTCCAAACGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024071.2-434s1c1
Sequence:CCGGGAAACTATGACTTGTCGTCTTCTCGAGAAGACGACAAGTCATAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024071.2-450s1c1
Sequence:CCGGGTCTTTCCAATAACCAGAGATCTCGAGATCTCTGGTTATTGGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024071.2-488s1c1
Sequence:CCGGGACAGCCACTATGAAATCGAACTCGAGTTCGATTTCATAGTGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024071.2-707s1c1
Sequence:CCGGGCCAAGCTCCTCTATGAATCTCTCGAGAGATTCATAGAGGAGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024071.2-192s21c1
Sequence:CCGGGTGACGCCAAGTTTGACTTTCCTCGAGGAAAGTCAAACTTGGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024071.2-813s21c1
Sequence:CCGGTTGCGTACCACAGGGATTAATCTCGAGATTAATCCCTGTGGTACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024071.2-580s21c1
Sequence:CCGGAGGCATGTTCCTGCAGTATACCTCGAGGTATACTGCAGGAACATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024071.2-1211s21c1
Sequence:CCGGCACTTACCTTGTCACTAATTTCTCGAGAAATTAGTGACAAGGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026752
ZFYVE21 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026752.2-670s1c1
Sequence:CCGGGCTACCAAGCTCCTCTATGAACTCGAGTTCATAGAGGAGCTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026752.2-948s1c1
Sequence:CCGGGCTTCTGTAAACTTCCAGGTTCTCGAGAACCTGGAAGTTTACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026752.2-164s1c1
Sequence:CCGGCCAAGTTTGACTTCATCACCACTCGAGTGGTGATGAAGTCAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026752.2-141s1c1
Sequence:CCGGCCCAAGATGTATGCAATGTGACTCGAGTCACATTGCATACATCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026752.2-684s1c1
Sequence:CCGGCTATGAATCACGAGACCAGTACTCGAGTACTGGTCTCGTGATTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026752
ZFYVE21 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026752.2-670s1c1
Sequence:CCGGGCTACCAAGCTCCTCTATGAACTCGAGTTCATAGAGGAGCTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026752.2-948s1c1
Sequence:CCGGGCTTCTGTAAACTTCCAGGTTCTCGAGAACCTGGAAGTTTACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026752.2-164s1c1
Sequence:CCGGCCAAGTTTGACTTCATCACCACTCGAGTGGTGATGAAGTCAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026752.2-141s1c1
Sequence:CCGGCCCAAGATGTATGCAATGTGACTCGAGTCACATTGCATACATCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026752.2-684s1c1
Sequence:CCGGCTATGAATCACGAGACCAGTACTCGAGTACTGGTCTCGTGATTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026752
ZFYVE21 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026752.2-670s1c1
Sequence:CCGGGCTACCAAGCTCCTCTATGAACTCGAGTTCATAGAGGAGCTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026752.2-948s1c1
Sequence:CCGGGCTTCTGTAAACTTCCAGGTTCTCGAGAACCTGGAAGTTTACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026752.2-164s1c1
Sequence:CCGGCCAAGTTTGACTTCATCACCACTCGAGTGGTGATGAAGTCAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026752.2-141s1c1
Sequence:CCGGCCCAAGATGTATGCAATGTGACTCGAGTCACATTGCATACATCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026752.2-684s1c1
Sequence:CCGGCTATGAATCACGAGACCAGTACTCGAGTACTGGTCTCGTGATTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks