EMAIL THIS PAGE TO A FRIEND

ZFYVE26

zinc finger, FYVE domain containing 26

Synonyms: FYVE-CENT SPG15
Gene ID:
Human(23503) Summary: This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
Mouse(211978) zinc finger, FYVE domain containing 26
Rat(314265) zinc finger, FYVE domain containing 26
Zebrafish(324565) zinc finger, FYVE domain containing 26
Horse(100063436) zinc finger, FYVE domain containing 26
dog(490745) zinc finger, FYVE domain containing 26
domestic cat(101093866) zinc finger, FYVE domain containing 26
chicken(423276) zinc finger, FYVE domain containing 26
domestic guinea pig(100719146) zinc finger, FYVE domain containing 26
naked mole-rat(101714566) zinc finger, FYVE domain containing 26
Domestic Rabbit(100353465) zinc finger, FYVE domain containing 26
cow(514402) zinc finger, FYVE domain containing 26
sheep(101116056) zinc finger, FYVE domain containing 26
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015346 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001008550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015346 Rosetta Predictions human pricing
NM_001108038 Rosetta Predictions rat pricing
NM_001008550 Rosetta Predictions mouse pricing
XM_899272 Rosetta Predictions mouse pricing
XM_899301 Rosetta Predictions mouse pricing
XM_899307 Rosetta Predictions mouse pricing
XM_899313 Rosetta Predictions mouse pricing
XM_986993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191196 predicted 3160
2 SASI_Hs01_00191197 predicted 5446
3 SASI_Hs01_00191198 predicted 6889
4 SASI_Hs01_00191199 predicted 6086
5 SASI_Hs02_00347653 predicted 6946
6 SASI_Hs01_00191200 predicted 4449
7 SASI_Hs01_00191201 predicted 3792
8 SASI_Hs01_00191202 predicted 5695
9 SASI_Hs01_00191203 predicted 6874
10 SASI_Hs01_00191204 predicted 2093
11 SASI_Hs01_00191205 predicted 4912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234745 predicted 360
2 SASI_Rn02_00234746 predicted 6972
3 SASI_Rn02_00234747 predicted 970
4 SASI_Rn02_00234748 predicted 6224
5 SASI_Rn02_00234749 predicted 5052
6 SASI_Rn02_00234750 predicted 6440
7 SASI_Rn02_00234751 predicted 7799
8 SASI_Rn02_00234752 predicted 3007
9 SASI_Rn02_00234753 predicted 6702
10 SASI_Rn02_00234754 predicted 5813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286825 predicted 7255
2 SASI_Mm02_00286826 predicted 7773
3 SASI_Mm02_00286827 predicted 6865
4 SASI_Mm02_00286828 predicted 6936
5 SASI_Mm02_00286829 predicted 953
6 SASI_Mm02_00286830 predicted 1772
7 SASI_Mm02_00286831 predicted 2998
8 SASI_Mm02_00286832 predicted 4992
9 SASI_Mm02_00286833 predicted 4671
10 SASI_Mm02_00286834 predicted 4925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205873 predicted 388
2 SASI_Mm01_00205874 predicted 2491
3 SASI_Mm01_00205875 predicted 2749
4 SASI_Mm01_00205876 predicted 1015
5 SASI_Mm01_00205877 predicted 2757
6 SASI_Mm01_00205878 predicted 3875
7 SASI_Mm01_00205879 predicted 986
8 SASI_Mm01_00205880 predicted 1792
9 SASI_Mm01_00205881 predicted 3033
10 SASI_Mm01_00205882 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203654 predicted 1001
2 SASI_Mm01_00203655 predicted 999
3 SASI_Mm01_00203656 predicted 455
4 SASI_Mm01_00203657 predicted 1007
5 SASI_Mm01_00203658 predicted 291
6 SASI_Mm01_00203659 predicted 339
7 SASI_Mm01_00203660 predicted 1011
8 SASI_Mm01_00203661 predicted 1013
9 SASI_Mm01_00203662 predicted 342
10 SASI_Mm01_00203663 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264498 predicted 2489
2 SASI_Mm01_00264499 predicted 2222
3 SASI_Mm01_00264500 predicted 2286
4 SASI_Mm01_00264501 predicted 1497
5 SASI_Mm01_00264502 predicted 1709
6 SASI_Mm01_00264503 predicted 2307
7 SASI_Mm01_00264504 predicted 1933
8 SASI_Mm01_00264505 predicted 1646
9 SASI_Mm01_00264506 predicted 1126
10 SASI_Mm01_00264507 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275943 predicted 1019
2 SASI_Mm01_00275944 predicted 1095
3 SASI_Mm01_00275945 predicted 1083
4 SASI_Mm01_00275946 predicted 786
5 SASI_Mm01_00275947 predicted 1006
6 SASI_Mm01_00275948 predicted 966
7 SASI_Mm01_00275949 predicted 682
8 SASI_Mm01_00275950 predicted 943
9 SASI_Mm01_00275951 predicted 930
10 SASI_Mm01_00275952 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214422 predicted 5033
2 SASI_Mm01_00214423 predicted 5107
3 SASI_Mm01_00214424 predicted 5092
4 SASI_Mm01_00214425 predicted 4794
5 SASI_Mm01_00214426 predicted 5017
6 SASI_Mm01_00214427 predicted 4970
7 SASI_Mm01_00214428 predicted 4699
8 SASI_Mm01_00214429 predicted 4956
9 SASI_Mm01_00214430 predicted 4945
10 SASI_Mm01_00214431 predicted 4996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015346
VALIDATED
ZFYVE26 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 26
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015346.3-4457s21c1
Sequence:CCGGGTGGACGATTTGAGCAGCATACTCGAGTATGCTGCTCAAATCGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015346.3-8087s21c1
Sequence:CCGGTGAAACTCTTCTCCATTTAAACTCGAGTTTAAATGGAGAAGAGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015346.3-6094s21c1
Sequence:CCGGCGCCAAGATGATGTTCGTCAACTCGAGTTGACGAACATCATCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015346.3-7554s21c1
Sequence:CCGGAGGTTCGGGCCTACCTGATATCTCGAGATATCAGGTAGGCCCGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015346.3-1203s21c1
Sequence:CCGGGCTGCCTACTTGATAGAGAATCTCGAGATTCTCTATCAAGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015346.2-3124s1c1
Sequence:CCGGCGGCGTTTGAATAGTAGCCTTCTCGAGAAGGCTACTATTCAAACGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015346.2-4453s1c1
Sequence:CCGGGTGGACGATTTGAGCAGCATACTCGAGTATGCTGCTCAAATCGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015346.2-6090s1c1
Sequence:CCGGCGCCAAGATGATGTTCGTCAACTCGAGTTGACGAACATCATCTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015346.2-496s1c1
Sequence:CCGGGAGGAGCTGTATGAGACCTTACTCGAGTAAGGTCTCATACAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015346.2-2776s1c1
Sequence:CCGGGCCCAAGTAGAGCACAAGATTCTCGAGAATCTTGTGCTCTACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015346.2-6091s1c1
Sequence:CCGGGCCAAGATGATGTTCGTCAAACTCGAGTTTGACGAACATCATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015346.2-8062s1c1
Sequence:CCGGGCCCAAGCATTTCTGAACAAACTCGAGTTTGTTCAGAAATGCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015346.2-9443s1c1
Sequence:CCGGGCAGCCCTTAATTTGGGATAACTCGAGTTATCCCAAATTAAGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015346.2-6910s1c1
Sequence:CCGGCAGTTTATGAAGGACCAAGTTCTCGAGAACTTGGTCCTTCATAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015346.2-1199s1c1
Sequence:CCGGGCTGCCTACTTGATAGAGAATCTCGAGATTCTCTATCAAGTAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015346
VALIDATED
ZFYVE26 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 26
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015346.3-4457s21c1
Sequence:CCGGGTGGACGATTTGAGCAGCATACTCGAGTATGCTGCTCAAATCGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015346.3-8087s21c1
Sequence:CCGGTGAAACTCTTCTCCATTTAAACTCGAGTTTAAATGGAGAAGAGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015346.3-6094s21c1
Sequence:CCGGCGCCAAGATGATGTTCGTCAACTCGAGTTGACGAACATCATCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015346.3-7554s21c1
Sequence:CCGGAGGTTCGGGCCTACCTGATATCTCGAGATATCAGGTAGGCCCGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015346.3-1203s21c1
Sequence:CCGGGCTGCCTACTTGATAGAGAATCTCGAGATTCTCTATCAAGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015346.2-3124s1c1
Sequence:CCGGCGGCGTTTGAATAGTAGCCTTCTCGAGAAGGCTACTATTCAAACGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015346.2-4453s1c1
Sequence:CCGGGTGGACGATTTGAGCAGCATACTCGAGTATGCTGCTCAAATCGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015346.2-6090s1c1
Sequence:CCGGCGCCAAGATGATGTTCGTCAACTCGAGTTGACGAACATCATCTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015346.2-496s1c1
Sequence:CCGGGAGGAGCTGTATGAGACCTTACTCGAGTAAGGTCTCATACAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015346.2-2776s1c1
Sequence:CCGGGCCCAAGTAGAGCACAAGATTCTCGAGAATCTTGTGCTCTACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015346.2-6091s1c1
Sequence:CCGGGCCAAGATGATGTTCGTCAAACTCGAGTTTGACGAACATCATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015346.2-8062s1c1
Sequence:CCGGGCCCAAGCATTTCTGAACAAACTCGAGTTTGTTCAGAAATGCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015346.2-9443s1c1
Sequence:CCGGGCAGCCCTTAATTTGGGATAACTCGAGTTATCCCAAATTAAGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015346.2-6910s1c1
Sequence:CCGGCAGTTTATGAAGGACCAAGTTCTCGAGAACTTGGTCCTTCATAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015346.2-1199s1c1
Sequence:CCGGGCTGCCTACTTGATAGAGAATCTCGAGATTCTCTATCAAGTAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015346
VALIDATED
ZFYVE26 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 26
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015346.3-4457s21c1
Sequence:CCGGGTGGACGATTTGAGCAGCATACTCGAGTATGCTGCTCAAATCGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015346.3-8087s21c1
Sequence:CCGGTGAAACTCTTCTCCATTTAAACTCGAGTTTAAATGGAGAAGAGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015346.3-6094s21c1
Sequence:CCGGCGCCAAGATGATGTTCGTCAACTCGAGTTGACGAACATCATCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015346.3-7554s21c1
Sequence:CCGGAGGTTCGGGCCTACCTGATATCTCGAGATATCAGGTAGGCCCGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015346.3-1203s21c1
Sequence:CCGGGCTGCCTACTTGATAGAGAATCTCGAGATTCTCTATCAAGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015346.2-3124s1c1
Sequence:CCGGCGGCGTTTGAATAGTAGCCTTCTCGAGAAGGCTACTATTCAAACGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015346.2-4453s1c1
Sequence:CCGGGTGGACGATTTGAGCAGCATACTCGAGTATGCTGCTCAAATCGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015346.2-6090s1c1
Sequence:CCGGCGCCAAGATGATGTTCGTCAACTCGAGTTGACGAACATCATCTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015346.2-496s1c1
Sequence:CCGGGAGGAGCTGTATGAGACCTTACTCGAGTAAGGTCTCATACAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015346.2-2776s1c1
Sequence:CCGGGCCCAAGTAGAGCACAAGATTCTCGAGAATCTTGTGCTCTACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015346.2-6091s1c1
Sequence:CCGGGCCAAGATGATGTTCGTCAAACTCGAGTTTGACGAACATCATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015346.2-8062s1c1
Sequence:CCGGGCCCAAGCATTTCTGAACAAACTCGAGTTTGTTCAGAAATGCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015346.2-9443s1c1
Sequence:CCGGGCAGCCCTTAATTTGGGATAACTCGAGTTATCCCAAATTAAGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015346.2-6910s1c1
Sequence:CCGGCAGTTTATGAAGGACCAAGTTCTCGAGAACTTGGTCCTTCATAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015346.2-1199s1c1
Sequence:CCGGGCTGCCTACTTGATAGAGAATCTCGAGATTCTCTATCAAGTAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008550
VALIDATED
ZFYVE26 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 26
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008550.1-6187s21c1
Sequence:CCGGTACCGCCATGTACCATCTTTACTCGAGTAAAGATGGTACATGGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001008550.1-2743s21c1
Sequence:CCGGGAGCGATACCAAGAGGTAATCCTCGAGGATTACCTCTTGGTATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001008550.1-7574s21c1
Sequence:CCGGTACGTTCTGCCTACCTGATTGCTCGAGCAATCAGGTAGGCAGAACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001008550.1-8609s21c1
Sequence:CCGGTGTACCTCTTGAATTAGTTAACTCGAGTTAACTAATTCAAGAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001008550.1-2774s21c1
Sequence:CCGGCCCGCGTAGAACATAAGATTGCTCGAGCAATCTTATGTTCTACGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008550
VALIDATED
ZFYVE26 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 26
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008550.1-6187s21c1
Sequence:CCGGTACCGCCATGTACCATCTTTACTCGAGTAAAGATGGTACATGGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001008550.1-2743s21c1
Sequence:CCGGGAGCGATACCAAGAGGTAATCCTCGAGGATTACCTCTTGGTATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001008550.1-7574s21c1
Sequence:CCGGTACGTTCTGCCTACCTGATTGCTCGAGCAATCAGGTAGGCAGAACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001008550.1-8609s21c1
Sequence:CCGGTGTACCTCTTGAATTAGTTAACTCGAGTTAACTAATTCAAGAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001008550.1-2774s21c1
Sequence:CCGGCCCGCGTAGAACATAAGATTGCTCGAGCAATCTTATGTTCTACGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008550
VALIDATED
ZFYVE26 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 26
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008550.1-6187s21c1
Sequence:CCGGTACCGCCATGTACCATCTTTACTCGAGTAAAGATGGTACATGGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001008550.1-2743s21c1
Sequence:CCGGGAGCGATACCAAGAGGTAATCCTCGAGGATTACCTCTTGGTATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001008550.1-7574s21c1
Sequence:CCGGTACGTTCTGCCTACCTGATTGCTCGAGCAATCAGGTAGGCAGAACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001008550.1-8609s21c1
Sequence:CCGGTGTACCTCTTGAATTAGTTAACTCGAGTTAACTAATTCAAGAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001008550.1-2774s21c1
Sequence:CCGGCCCGCGTAGAACATAAGATTGCTCGAGCAATCTTATGTTCTACGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks