EMAIL THIS PAGE TO A FRIEND

ZFYVE27

zinc finger, FYVE domain containing 27

Synonyms: PROTRUDIN RP11-459F3.2 SPG33
Gene ID:
Human(118813) Summary: This gene encodes a protein with several transmembrane domains, a Rab11-binding domain and a lipid-binding FYVE finger domain. The encoded protein appears to promote neurite formation. A mutation in this gene has been reported to be associated with hereditary spastic paraplegia, however the pathogenicity of the mutation, which may simply represent a polymorphism, is unclear. [provided by RefSeq, Mar 2010]
Mouse(319740) zinc finger, FYVE domain containing 27
Rat(309376) zinc finger, FYVE domain containing 27
cow(514383) zinc finger, FYVE domain containing 27
sheep(101116270) zinc finger, FYVE domain containing 27
naked mole-rat(101703527) zinc finger, FYVE domain containing 27
domestic guinea pig(100722130) zinc finger, FYVE domain containing 27
Zebrafish(561659) zinc finger, FYVE domain containing 27
Horse(100060913) zinc finger, FYVE domain containing 27
domestic cat(101081083) zinc finger, FYVE domain containing 27
dog(486825) zinc finger, FYVE domain containing 27
chicken(423839) zinc finger, FYVE domain containing 27
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002261 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002261 Rosetta Predictions human pricing
NM_001002262 Rosetta Predictions human pricing
NM_144588 Rosetta Predictions human pricing
NM_199104 Rosetta Predictions rat pricing
NM_177319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175066 predicted 1593
2 SASI_Hs01_00175067 predicted 364
3 SASI_Hs01_00175068 predicted 768
4 SASI_Hs01_00175069 predicted 434
5 SASI_Hs01_00175070 predicted 1479
6 SASI_Hs02_00304152 predicted 401
7 SASI_Hs01_00175071 predicted 366
8 SASI_Hs01_00175072 predicted 1542
9 SASI_Hs01_00175073 predicted 1761
10 SASI_Hs01_00175074 predicted 1433
11 SASI_Hs01_00175075 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165474 predicted 1561
2 SASI_Hs01_00165475 predicted 355
3 SASI_Hs01_00165476 predicted 765
4 SASI_Hs01_00165477 predicted 431
5 SASI_Hs01_00165478 predicted 1440
6 SASI_Hs02_00304153 predicted 401
7 SASI_Hs01_00165479 predicted 364
8 SASI_Hs01_00165480 predicted 1504
9 SASI_Hs01_00165481 predicted 1731
10 SASI_Hs01_00165482 predicted 1396
11 SASI_Hs01_00165483 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134909 predicted 1577
2 SASI_Hs01_00134910 predicted 358
3 SASI_Hs01_00134911 predicted 765
4 SASI_Hs01_00134912 predicted 434
5 SASI_Hs01_00134913 predicted 1459
6 SASI_Hs02_00364379 predicted 406
7 SASI_Hs01_00134914 predicted 363
8 SASI_Hs01_00134915 predicted 1527
9 SASI_Hs01_00134916 predicted 1746
10 SASI_Hs01_00134917 predicted 1420
11 SASI_Hs01_00134918 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099259 predicted 1002
2 SASI_Rn01_00099260 predicted 1565
3 SASI_Rn01_00099261 predicted 1344
4 SASI_Rn01_00099262 predicted 650
5 SASI_Rn01_00099263 predicted 378
6 SASI_Rn02_00270124 predicted 648
7 SASI_Rn01_00099264 predicted 683
8 SASI_Rn01_00099265 predicted 1565
9 SASI_Rn01_00099266 predicted 778
10 SASI_Rn01_00099268 predicted 417
11 SASI_Rn01_00099267 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347403 predicted 1183
2 SASI_Mm02_00347404 predicted 1231
3 SASI_Mm02_00347405 predicted 396
4 SASI_Mm02_00347406 predicted 528
5 SASI_Mm02_00347407 predicted 1759
6 SASI_Mm02_00347408 predicted 1196
7 SASI_Mm02_00347409 predicted 1613
8 SASI_Mm02_00347410 predicted 681
9 SASI_Mm02_00347411 predicted 1622
10 SASI_Mm02_00347412 predicted 750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002261
VALIDATED
ZFYVE27 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 27
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002261.1-642s1c1
Sequence:CCGGGAAGAGCTTCTTGATCCAGCTCTCGAGAGCTGGATCAAGAAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002261.1-1422s1c1
Sequence:CCGGGTGTAACCAGACCTTGAGCAACTCGAGTTGCTCAAGGTCTGGTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002261.1-396s1c1
Sequence:CCGGGCAGATGCCTTTGTGTTCCTTCTCGAGAAGGAACACAAAGGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002261.1-852s1c1
Sequence:CCGGCTTCCGAGTTGTGTCTGAGTACTCGAGTACTCAGACACAACTCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002261.1-570s1c1
Sequence:CCGGGAAGTATCATAGCGTGAGGCACTCGAGTGCCTCACGCTATGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002261.1-1319s1c1
Sequence:CCGGGAAACAGCTTCTGCTCTCGATCTCGAGATCGAGAGCAGAAGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002261.1-435s1c1
Sequence:CCGGCAACGTCTTGTTCCTCACTTTCTCGAGAAAGTGAGGAACAAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002261.1-309s1c1
Sequence:CCGGCAACTTGGTTCTCTCCTACAACTCGAGTTGTAGGAGAGAACCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002261.1-2488s1c1
Sequence:CCGGCCAACAGTTTCATGTTCACTACTCGAGTAGTGAACATGAAACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002261.1-2584s1c1
Sequence:CCGGCCCTGCCTTTCTCAAGTATTTCTCGAGAAATACTTGAGAAAGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137404    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002261.1-2015s1c1
Sequence:CCGGGCTTCTAGAAACAGGGTTGAACTCGAGTTCAACCCTGTTTCTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002261
VALIDATED
ZFYVE27 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 27
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002261.1-642s1c1
Sequence:CCGGGAAGAGCTTCTTGATCCAGCTCTCGAGAGCTGGATCAAGAAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002261.1-1422s1c1
Sequence:CCGGGTGTAACCAGACCTTGAGCAACTCGAGTTGCTCAAGGTCTGGTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002261.1-396s1c1
Sequence:CCGGGCAGATGCCTTTGTGTTCCTTCTCGAGAAGGAACACAAAGGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002261.1-852s1c1
Sequence:CCGGCTTCCGAGTTGTGTCTGAGTACTCGAGTACTCAGACACAACTCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002261.1-570s1c1
Sequence:CCGGGAAGTATCATAGCGTGAGGCACTCGAGTGCCTCACGCTATGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002261.1-1319s1c1
Sequence:CCGGGAAACAGCTTCTGCTCTCGATCTCGAGATCGAGAGCAGAAGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002261.1-435s1c1
Sequence:CCGGCAACGTCTTGTTCCTCACTTTCTCGAGAAAGTGAGGAACAAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002261.1-309s1c1
Sequence:CCGGCAACTTGGTTCTCTCCTACAACTCGAGTTGTAGGAGAGAACCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002261.1-2488s1c1
Sequence:CCGGCCAACAGTTTCATGTTCACTACTCGAGTAGTGAACATGAAACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002261.1-2584s1c1
Sequence:CCGGCCCTGCCTTTCTCAAGTATTTCTCGAGAAATACTTGAGAAAGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137404    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002261.1-2015s1c1
Sequence:CCGGGCTTCTAGAAACAGGGTTGAACTCGAGTTCAACCCTGTTTCTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002261
VALIDATED
ZFYVE27 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 27
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002261.1-642s1c1
Sequence:CCGGGAAGAGCTTCTTGATCCAGCTCTCGAGAGCTGGATCAAGAAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002261.1-1422s1c1
Sequence:CCGGGTGTAACCAGACCTTGAGCAACTCGAGTTGCTCAAGGTCTGGTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002261.1-396s1c1
Sequence:CCGGGCAGATGCCTTTGTGTTCCTTCTCGAGAAGGAACACAAAGGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002261.1-852s1c1
Sequence:CCGGCTTCCGAGTTGTGTCTGAGTACTCGAGTACTCAGACACAACTCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002261.1-570s1c1
Sequence:CCGGGAAGTATCATAGCGTGAGGCACTCGAGTGCCTCACGCTATGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001002261.1-1319s1c1
Sequence:CCGGGAAACAGCTTCTGCTCTCGATCTCGAGATCGAGAGCAGAAGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002261.1-435s1c1
Sequence:CCGGCAACGTCTTGTTCCTCACTTTCTCGAGAAAGTGAGGAACAAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002261.1-309s1c1
Sequence:CCGGCAACTTGGTTCTCTCCTACAACTCGAGTTGTAGGAGAGAACCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002261.1-2488s1c1
Sequence:CCGGCCAACAGTTTCATGTTCACTACTCGAGTAGTGAACATGAAACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002261.1-2584s1c1
Sequence:CCGGCCCTGCCTTTCTCAAGTATTTCTCGAGAAATACTTGAGAAAGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137404    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002261.1-2015s1c1
Sequence:CCGGGCTTCTAGAAACAGGGTTGAACTCGAGTTCAACCCTGTTTCTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177319
VALIDATED
ZFYVE27 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 27
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177319.2-1392s1c1
Sequence:CCGGGCAATCAGACCCTGAGCAAATCTCGAGATTTGCTCAGGGTCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177319.2-409s1c1
Sequence:CCGGCATCTTGTTCCTCACTTTGAACTCGAGTTCAAAGTGAGGAACAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177319.2-3190s1c1
Sequence:CCGGGCCTTTAGAAAGAATGCACATCTCGAGATGTGCATTCTTTCTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177319.2-1195s1c1
Sequence:CCGGCAAGCGTTACCCAACCAATAACTCGAGTTATTGGTTGGGTAACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177319.2-4810s1c1
Sequence:CCGGCCTCTGTAGAAGGTGGTAATACTCGAGTATTACCACCTTCTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198561    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177319.2-5072s1c1
Sequence:CCGGGCCAGTGAACACTCCTTGAATCTCGAGATTCAAGGAGTGTTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177319.2-788s21c1
Sequence:CCGGTGGGTCCTCGCCCTGTTAAATCTCGAGATTTAACAGGGCGAGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177319.2-1605s21c1
Sequence:CCGGTTGGTTCTGCTCTATCCTATACTCGAGTATAGGATAGAGCAGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177319.2-1032s21c1
Sequence:CCGGAGGAGTTCAAAGATGCAATTGCTCGAGCAATTGCATCTTTGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177319.2-1195s21c1
Sequence:CCGGCAAGCGTTACCCAACCAATAACTCGAGTTATTGGTTGGGTAACGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177319.2-409s21c1
Sequence:CCGGCATCTTGTTCCTCACTTTGAACTCGAGTTCAAAGTGAGGAACAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177319
VALIDATED
ZFYVE27 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 27
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177319.2-1392s1c1
Sequence:CCGGGCAATCAGACCCTGAGCAAATCTCGAGATTTGCTCAGGGTCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177319.2-409s1c1
Sequence:CCGGCATCTTGTTCCTCACTTTGAACTCGAGTTCAAAGTGAGGAACAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177319.2-3190s1c1
Sequence:CCGGGCCTTTAGAAAGAATGCACATCTCGAGATGTGCATTCTTTCTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177319.2-1195s1c1
Sequence:CCGGCAAGCGTTACCCAACCAATAACTCGAGTTATTGGTTGGGTAACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177319.2-4810s1c1
Sequence:CCGGCCTCTGTAGAAGGTGGTAATACTCGAGTATTACCACCTTCTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198561    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177319.2-5072s1c1
Sequence:CCGGGCCAGTGAACACTCCTTGAATCTCGAGATTCAAGGAGTGTTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177319.2-788s21c1
Sequence:CCGGTGGGTCCTCGCCCTGTTAAATCTCGAGATTTAACAGGGCGAGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177319.2-1605s21c1
Sequence:CCGGTTGGTTCTGCTCTATCCTATACTCGAGTATAGGATAGAGCAGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177319.2-1032s21c1
Sequence:CCGGAGGAGTTCAAAGATGCAATTGCTCGAGCAATTGCATCTTTGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177319.2-1195s21c1
Sequence:CCGGCAAGCGTTACCCAACCAATAACTCGAGTTATTGGTTGGGTAACGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177319.2-409s21c1
Sequence:CCGGCATCTTGTTCCTCACTTTGAACTCGAGTTCAAAGTGAGGAACAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177319
VALIDATED
ZFYVE27 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 27
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177319.2-1392s1c1
Sequence:CCGGGCAATCAGACCCTGAGCAAATCTCGAGATTTGCTCAGGGTCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177319.2-409s1c1
Sequence:CCGGCATCTTGTTCCTCACTTTGAACTCGAGTTCAAAGTGAGGAACAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177319.2-3190s1c1
Sequence:CCGGGCCTTTAGAAAGAATGCACATCTCGAGATGTGCATTCTTTCTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177319.2-1195s1c1
Sequence:CCGGCAAGCGTTACCCAACCAATAACTCGAGTTATTGGTTGGGTAACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177319.2-4810s1c1
Sequence:CCGGCCTCTGTAGAAGGTGGTAATACTCGAGTATTACCACCTTCTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198561    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177319.2-5072s1c1
Sequence:CCGGGCCAGTGAACACTCCTTGAATCTCGAGATTCAAGGAGTGTTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177319.2-788s21c1
Sequence:CCGGTGGGTCCTCGCCCTGTTAAATCTCGAGATTTAACAGGGCGAGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177319.2-1605s21c1
Sequence:CCGGTTGGTTCTGCTCTATCCTATACTCGAGTATAGGATAGAGCAGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177319.2-1032s21c1
Sequence:CCGGAGGAGTTCAAAGATGCAATTGCTCGAGCAATTGCATCTTTGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177319.2-1195s21c1
Sequence:CCGGCAAGCGTTACCCAACCAATAACTCGAGTTATTGGTTGGGTAACGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177319.2-409s21c1
Sequence:CCGGCATCTTGTTCCTCACTTTGAACTCGAGTTCAAAGTGAGGAACAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks