EMAIL THIS PAGE TO A FRIEND

ZFYVE28

zinc finger, FYVE domain containing 28

Synonyms: LST2 LYST2
Gene ID:
Mouse(231125) zinc finger, FYVE domain containing 28
Rat(305454) zinc finger, FYVE domain containing 28
Zebrafish(777615) zinc finger, FYVE domain containing 28
Horse(100146275) zinc finger, FYVE domain containing 28
domestic cat(101084445) zinc finger, FYVE domain containing 28
dog(488802) zinc finger, FYVE domain containing 28
chicken(422889) zinc finger, FYVE domain containing 28
domestic guinea pig(100734074) zinc finger, FYVE domain containing 28
naked mole-rat(101705015) zinc finger, FYVE domain containing 28
cow(522574) zinc finger, FYVE domain containing 28
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020972 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001015039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001015039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001015039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158491 MISSION® esiRNA esiRNA human ZFYVE28 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020972 Rosetta Predictions human pricing
NM_001107227 Rosetta Predictions rat pricing
NM_001015039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137533 predicted 1652
2 SASI_Hs01_00137534 predicted 1818
3 SASI_Hs01_00137535 predicted 580
4 SASI_Hs01_00137536 predicted 2089
5 SASI_Hs02_00354408 predicted 1268
6 SASI_Hs01_00137537 predicted 1980
7 SASI_Hs02_00354409 predicted 2944
8 SASI_Hs01_00137539 predicted 1120
9 SASI_Hs02_00354410 predicted 2078
10 SASI_Hs02_00354411 predicted 488
11 SASI_Hs01_00137531 predicted 2560
12 SASI_Hs01_00137532 predicted 2916
13 SASI_Hs01_00137538 predicted 1166
14 SASI_Hs01_00137540 predicted 3177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226765 predicted 503
2 SASI_Rn02_00226766 predicted 1756
3 SASI_Rn02_00226767 predicted 2463
4 SASI_Rn02_00226768 predicted 2085
5 SASI_Rn02_00226769 predicted 2453
6 SASI_Rn02_00226770 predicted 1906
7 SASI_Rn02_00226771 predicted 1662
8 SASI_Rn02_00226772 predicted 2414
9 SASI_Rn02_00226773 predicted 676
10 SASI_Rn02_00226774 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029240 predicted 1534
2 SASI_Mm01_00029241 predicted 426
3 SASI_Mm01_00029242 predicted 233
4 SASI_Mm01_00029243 predicted 1672
5 SASI_Mm01_00029244 predicted 688
6 SASI_Mm01_00029245 predicted 1373
7 SASI_Mm02_00287454 predicted 515
8 SASI_Mm01_00029246 predicted 680
9 SASI_Mm01_00029247 predicted 2686
10 SASI_Mm01_00029248 predicted 2199
11 SASI_Mm01_00029249 predicted 1247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020972
VALIDATED
ZFYVE28 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 28
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020972.1-3429s21c1
Sequence:CCGGTGTGCCTCCCAAACGTCAAATCTCGAGATTTGACGTTTGGGAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020972.1-375s21c1
Sequence:CCGGTGCTTGCCCGGTTCTACTATGCTCGAGCATAGTAGAACCGGGCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020972.1-2560s21c1
Sequence:CCGGTGACCTGAGAAGTATTCTTAACTCGAGTTAAGAATACTTCTCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020972.1-2535s21c1
Sequence:CCGGACCAGCTGCAGACGAACTATGCTCGAGCATAGTTCGTCTGCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020972.1-502s21c1
Sequence:CCGGCAATGTGTTGAACATCATTAACTCGAGTTAATGATGTTCAACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020972.1-562s1c1
Sequence:CCGGCAGAGATTTCTGCGTCAAGTTCTCGAGAACTTGACGCAGAAATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-2610s1c1
Sequence:CCGGCTGAAACAGACGACAAGGAAACTCGAGTTTCCTTGTCGTCTGTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020972.1-3523s1c1
Sequence:CCGGCCTCAGGACTTGGCTAAACAACTCGAGTTGTTTAGCCAAGTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020972.1-1379s1c1
Sequence:CCGGGACGAGATGTCCTCTTTGCTTCTCGAGAAGCAAAGAGGACATCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-2605s1c1
Sequence:CCGGCAAGCCTGAAACAGACGACAACTCGAGTTGTCGTCTGTTTCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-2929s1c1
Sequence:CCGGCCACTGCTACATGTTCCATGTCTCGAGACATGGAACATGTAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020972.1-2609s1c1
Sequence:CCGGCCTGAAACAGACGACAAGGAACTCGAGTTCCTTGTCGTCTGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-1516s1c1
Sequence:CCGGCGTGTTCTTCATGGATGACGTCTCGAGACGTCATCCATGAAGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-523s1c1
Sequence:CCGGCCAGATCATGGATGAGTGCATCTCGAGATGCACTCATCCATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-946s1c1
Sequence:CCGGGTACCTGACTCAGGACATGATCTCGAGATCATGTCCTGAGTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020972.1-3437s1c1
Sequence:CCGGCCAAACGTCAAATGCAGGCTACTCGAGTAGCCTGCATTTGACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-1985s1c1
Sequence:CCGGGCCACCAACTGCCTTCTGCATCTCGAGATGCAGAAGGCAGTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-508s1c1
Sequence:CCGGGTTGAACATCATTAACCAGATCTCGAGATCTGGTTAATGATGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020972.1-3535s1c1
Sequence:CCGGGCTAAACAACATGCATCTCATCTCGAGATGAGATGCATGTTGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020972
VALIDATED
ZFYVE28 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 28
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020972.1-3429s21c1
Sequence:CCGGTGTGCCTCCCAAACGTCAAATCTCGAGATTTGACGTTTGGGAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020972.1-375s21c1
Sequence:CCGGTGCTTGCCCGGTTCTACTATGCTCGAGCATAGTAGAACCGGGCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020972.1-2560s21c1
Sequence:CCGGTGACCTGAGAAGTATTCTTAACTCGAGTTAAGAATACTTCTCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020972.1-2535s21c1
Sequence:CCGGACCAGCTGCAGACGAACTATGCTCGAGCATAGTTCGTCTGCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020972.1-502s21c1
Sequence:CCGGCAATGTGTTGAACATCATTAACTCGAGTTAATGATGTTCAACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020972.1-562s1c1
Sequence:CCGGCAGAGATTTCTGCGTCAAGTTCTCGAGAACTTGACGCAGAAATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-2610s1c1
Sequence:CCGGCTGAAACAGACGACAAGGAAACTCGAGTTTCCTTGTCGTCTGTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020972.1-3523s1c1
Sequence:CCGGCCTCAGGACTTGGCTAAACAACTCGAGTTGTTTAGCCAAGTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020972.1-1379s1c1
Sequence:CCGGGACGAGATGTCCTCTTTGCTTCTCGAGAAGCAAAGAGGACATCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-2605s1c1
Sequence:CCGGCAAGCCTGAAACAGACGACAACTCGAGTTGTCGTCTGTTTCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-2929s1c1
Sequence:CCGGCCACTGCTACATGTTCCATGTCTCGAGACATGGAACATGTAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020972.1-2609s1c1
Sequence:CCGGCCTGAAACAGACGACAAGGAACTCGAGTTCCTTGTCGTCTGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-1516s1c1
Sequence:CCGGCGTGTTCTTCATGGATGACGTCTCGAGACGTCATCCATGAAGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-523s1c1
Sequence:CCGGCCAGATCATGGATGAGTGCATCTCGAGATGCACTCATCCATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-946s1c1
Sequence:CCGGGTACCTGACTCAGGACATGATCTCGAGATCATGTCCTGAGTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020972.1-3437s1c1
Sequence:CCGGCCAAACGTCAAATGCAGGCTACTCGAGTAGCCTGCATTTGACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-1985s1c1
Sequence:CCGGGCCACCAACTGCCTTCTGCATCTCGAGATGCAGAAGGCAGTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-508s1c1
Sequence:CCGGGTTGAACATCATTAACCAGATCTCGAGATCTGGTTAATGATGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020972.1-3535s1c1
Sequence:CCGGGCTAAACAACATGCATCTCATCTCGAGATGAGATGCATGTTGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020972
VALIDATED
ZFYVE28 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 28
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020972.1-3429s21c1
Sequence:CCGGTGTGCCTCCCAAACGTCAAATCTCGAGATTTGACGTTTGGGAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020972.1-375s21c1
Sequence:CCGGTGCTTGCCCGGTTCTACTATGCTCGAGCATAGTAGAACCGGGCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020972.1-2560s21c1
Sequence:CCGGTGACCTGAGAAGTATTCTTAACTCGAGTTAAGAATACTTCTCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020972.1-2535s21c1
Sequence:CCGGACCAGCTGCAGACGAACTATGCTCGAGCATAGTTCGTCTGCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020972.1-502s21c1
Sequence:CCGGCAATGTGTTGAACATCATTAACTCGAGTTAATGATGTTCAACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020972.1-562s1c1
Sequence:CCGGCAGAGATTTCTGCGTCAAGTTCTCGAGAACTTGACGCAGAAATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-2610s1c1
Sequence:CCGGCTGAAACAGACGACAAGGAAACTCGAGTTTCCTTGTCGTCTGTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020972.1-3523s1c1
Sequence:CCGGCCTCAGGACTTGGCTAAACAACTCGAGTTGTTTAGCCAAGTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020972.1-1379s1c1
Sequence:CCGGGACGAGATGTCCTCTTTGCTTCTCGAGAAGCAAAGAGGACATCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-2605s1c1
Sequence:CCGGCAAGCCTGAAACAGACGACAACTCGAGTTGTCGTCTGTTTCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-2929s1c1
Sequence:CCGGCCACTGCTACATGTTCCATGTCTCGAGACATGGAACATGTAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020972.1-2609s1c1
Sequence:CCGGCCTGAAACAGACGACAAGGAACTCGAGTTCCTTGTCGTCTGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-1516s1c1
Sequence:CCGGCGTGTTCTTCATGGATGACGTCTCGAGACGTCATCCATGAAGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-523s1c1
Sequence:CCGGCCAGATCATGGATGAGTGCATCTCGAGATGCACTCATCCATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-946s1c1
Sequence:CCGGGTACCTGACTCAGGACATGATCTCGAGATCATGTCCTGAGTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020972.1-3437s1c1
Sequence:CCGGCCAAACGTCAAATGCAGGCTACTCGAGTAGCCTGCATTTGACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-1985s1c1
Sequence:CCGGGCCACCAACTGCCTTCTGCATCTCGAGATGCAGAAGGCAGTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020972.1-508s1c1
Sequence:CCGGGTTGAACATCATTAACCAGATCTCGAGATCTGGTTAATGATGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145372    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020972.1-3535s1c1
Sequence:CCGGGCTAAACAACATGCATCTCATCTCGAGATGAGATGCATGTTGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001015039
ZFYVE28 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 28
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000098545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001015039.1-3317s1c1
Sequence:CCGGGCCAAGAATCTGGAAACAGAACTCGAGTTCTGTTTCCAGATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015039.1-1181s1c1
Sequence:CCGGGCCTGCTCAATGCAGTATGATCTCGAGATCATACTGCATTGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015039.1-692s1c1
Sequence:CCGGGCTGAGTTTGAACTGAGCTATCTCGAGATAGCTCAGTTCAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015039.1-1978s1c1
Sequence:CCGGCCCTTCTGTAAGCTTAGCCAACTCGAGTTGGCTAAGCTTACAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001015039
ZFYVE28 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 28
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000098545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001015039.1-3317s1c1
Sequence:CCGGGCCAAGAATCTGGAAACAGAACTCGAGTTCTGTTTCCAGATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015039.1-1181s1c1
Sequence:CCGGGCCTGCTCAATGCAGTATGATCTCGAGATCATACTGCATTGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015039.1-692s1c1
Sequence:CCGGGCTGAGTTTGAACTGAGCTATCTCGAGATAGCTCAGTTCAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015039.1-1978s1c1
Sequence:CCGGCCCTTCTGTAAGCTTAGCCAACTCGAGTTGGCTAAGCTTACAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001015039
ZFYVE28 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 28
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000098545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001015039.1-3317s1c1
Sequence:CCGGGCCAAGAATCTGGAAACAGAACTCGAGTTCTGTTTCCAGATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015039.1-1181s1c1
Sequence:CCGGGCCTGCTCAATGCAGTATGATCTCGAGATCATACTGCATTGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015039.1-692s1c1
Sequence:CCGGGCTGAGTTTGAACTGAGCTATCTCGAGATAGCTCAGTTCAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015039.1-1978s1c1
Sequence:CCGGCCCTTCTGTAAGCTTAGCCAACTCGAGTTGGCTAAGCTTACAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks