EMAIL THIS PAGE TO A FRIEND

ZFYVE9

zinc finger, FYVE domain containing 9

Synonyms: MADHIP NSP SARA SMADIP
UniProtKB ID: O95405, Q5T0F6, Q5T0F7, Q9UNE1, Q9Y5R7
Gene ID:
Human(9372) Summary: This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Mouse(230597) zinc finger, FYVE domain containing 9
Rat(313477) zinc finger, FYVE domain containing 9
cow(613428) zinc finger, FYVE domain containing 9
sheep(101114400) zinc finger, FYVE domain containing 9
naked mole-rat(101711904) zinc finger, FYVE domain containing 9
Domestic Rabbit(100356819) zinc finger, FYVE domain containing 9
domestic guinea pig(100729318) zinc finger, FYVE domain containing 9
chicken(424639) zinc finger, FYVE domain containing 9
dog(475352) zinc finger, FYVE domain containing 9
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004799 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004799 Rosetta Predictions human pricing
NM_007323 Rosetta Predictions human pricing
NM_007324 Rosetta Predictions human pricing
NM_001107952 Rosetta Predictions rat pricing
NM_183300 Rosetta Predictions mouse pricing
XM_131643 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338331 predicted 1071
2 SASI_Hs01_00147952 predicted 1572
3 SASI_Hs01_00147953 predicted 2168
4 SASI_Hs02_00338332 predicted 1698
5 SASI_Hs01_00147955 predicted 525
6 SASI_Hs01_00147957 predicted 1364
7 SASI_Hs01_00147958 predicted 963
8 SASI_Hs02_00338333 predicted 2065
9 SASI_Hs01_00147959 predicted 1586
10 SASI_Hs01_00147961 predicted 802
11 SASI_Hs01_00147954 predicted 1352
12 SASI_Hs01_00147956 predicted 1881
13 SASI_Hs01_00147960 predicted 2088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343395 predicted 1074
2 SASI_Hs01_00238835 predicted 1573
3 SASI_Hs01_00238836 predicted 2166
4 SASI_Hs02_00343396 predicted 1696
5 SASI_Hs01_00238838 predicted 520
6 SASI_Hs01_00238840 predicted 1361
7 SASI_Hs01_00238841 predicted 965
8 SASI_Hs02_00343397 predicted 2063
9 SASI_Hs01_00238842 predicted 1584
10 SASI_Hs01_00238844 predicted 809
11 SASI_Hs01_00238837 predicted 1358
12 SASI_Hs01_00238839 predicted 1885
13 SASI_Hs01_00238843 predicted 2081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343398 predicted 1069
2 SASI_Hs01_00074213 predicted 1571
3 SASI_Hs01_00074214 predicted 2167
4 SASI_Hs02_00343399 predicted 1690
5 SASI_Hs01_00074216 predicted 525
6 SASI_Hs01_00074218 predicted 1365
7 SASI_Hs01_00074219 predicted 964
8 SASI_Hs02_00343400 predicted 2064
9 SASI_Hs01_00074220 predicted 1590
10 SASI_Hs01_00074222 predicted 810
11 SASI_Hs01_00074215 predicted 1357
12 SASI_Hs01_00074217 predicted 1883
13 SASI_Hs01_00074221 predicted 2083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233905 predicted 3570
2 SASI_Rn02_00233906 predicted 2774
3 SASI_Rn02_00233907 predicted 2005
4 SASI_Rn02_00233908 predicted 2694
5 SASI_Rn02_00233909 predicted 3700
6 SASI_Rn02_00233910 predicted 3893
7 SASI_Rn02_00233911 predicted 1778
8 SASI_Rn02_00233912 predicted 1314
9 SASI_Rn02_00233913 predicted 3119
10 SASI_Rn02_00233914 predicted 3558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350412 predicted 302
2 SASI_Mm02_00350413 predicted 433
3 SASI_Mm02_00350414 predicted 809
4 SASI_Mm02_00350415 predicted 1344
5 SASI_Mm02_00350416 predicted 371
6 SASI_Mm02_00350417 predicted 645
7 SASI_Mm02_00350418 predicted 1470
8 SASI_Mm02_00350419 predicted 1746
9 SASI_Mm02_00350420 predicted 1343
10 SASI_Mm02_00350421 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206439 predicted 2799
2 SASI_Mm01_00206440 predicted 2441
3 SASI_Mm01_00206441 predicted 1764
4 SASI_Mm01_00206442 predicted 977
5 SASI_Mm01_00206443 predicted 3304
6 SASI_Mm01_00206444 predicted 1779
7 SASI_Mm01_00206445 predicted 2168
8 SASI_Mm01_00206446 predicted 3978
9 SASI_Mm01_00206447 predicted 4244
10 SASI_Mm01_00206448 predicted 3764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004799
ZFYVE9 MISSION shRNA Bacterial Glycerol Stock
zinc finger, FYVE domain containing 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004799.2-4503s1c1
Sequence:CCGGCCCAAATCATTTGCACTTTAACTCGAGTTAAAGTGCAAATGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004799.2-2699s1c1
Sequence:CCGGGCAGCCAAATTAACAATGAATCTCGAGATTCATTGTTAATTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004799.2-1879s1c1
Sequence:CCGGGCCATCTATCAGTGTTCCTTTCTCGAGAAAGGAACACTGATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004799.2-3433s1c1
Sequence:CCGGCCCACTATTCAGTGTCAGATTCTCGAGAATCTGACACTGAATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004799.2-310s1c1
Sequence:CCGGGCTGTCATTTAACCCTACTTTCTCGAGAAAGTAGGGTTAAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004799.2-2787s21c1
Sequence:CCGGTACCAGCAGAGACGGATATTTCTCGAGAAATATCCGTCTCTGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004799.2-4749s21c1
Sequence:CCGGTCCGCTCCTCTCTCAAGATTTCTCGAGAAATCTTGAGAGAGGAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004799.2-1370s21c1
Sequence:CCGGACTAATTGGAAGTTGACTAAACTCGAGTTTAGTCAACTTCCAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004799.2-1077s21c1
Sequence:CCGGCAGATCTAGGGAGTCCAAATTCTCGAGAATTTGGACTCCCTAGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004799.2-1499s21c1
Sequence:CCGGGCAGATGCAGGTCTAGATTTACTCGAGTAAATCTAGACCTGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004799
ZFYVE9 MISSION shRNA shRNA Plasmid DNA
zinc finger, FYVE domain containing 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004799.2-4503s1c1
Sequence:CCGGCCCAAATCATTTGCACTTTAACTCGAGTTAAAGTGCAAATGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004799.2-2699s1c1
Sequence:CCGGGCAGCCAAATTAACAATGAATCTCGAGATTCATTGTTAATTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004799.2-1879s1c1
Sequence:CCGGGCCATCTATCAGTGTTCCTTTCTCGAGAAAGGAACACTGATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004799.2-3433s1c1
Sequence:CCGGCCCACTATTCAGTGTCAGATTCTCGAGAATCTGACACTGAATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004799.2-310s1c1
Sequence:CCGGGCTGTCATTTAACCCTACTTTCTCGAGAAAGTAGGGTTAAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004799.2-2787s21c1
Sequence:CCGGTACCAGCAGAGACGGATATTTCTCGAGAAATATCCGTCTCTGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004799.2-4749s21c1
Sequence:CCGGTCCGCTCCTCTCTCAAGATTTCTCGAGAAATCTTGAGAGAGGAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004799.2-1370s21c1
Sequence:CCGGACTAATTGGAAGTTGACTAAACTCGAGTTTAGTCAACTTCCAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004799.2-1077s21c1
Sequence:CCGGCAGATCTAGGGAGTCCAAATTCTCGAGAATTTGGACTCCCTAGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004799.2-1499s21c1
Sequence:CCGGGCAGATGCAGGTCTAGATTTACTCGAGTAAATCTAGACCTGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004799
ZFYVE9 MISSION shRNA Lentiviral Transduction Particles
zinc finger, FYVE domain containing 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004799.2-4503s1c1
Sequence:CCGGCCCAAATCATTTGCACTTTAACTCGAGTTAAAGTGCAAATGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004799.2-2699s1c1
Sequence:CCGGGCAGCCAAATTAACAATGAATCTCGAGATTCATTGTTAATTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004799.2-1879s1c1
Sequence:CCGGGCCATCTATCAGTGTTCCTTTCTCGAGAAAGGAACACTGATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004799.2-3433s1c1
Sequence:CCGGCCCACTATTCAGTGTCAGATTCTCGAGAATCTGACACTGAATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004799.2-310s1c1
Sequence:CCGGGCTGTCATTTAACCCTACTTTCTCGAGAAAGTAGGGTTAAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004799.2-2787s21c1
Sequence:CCGGTACCAGCAGAGACGGATATTTCTCGAGAAATATCCGTCTCTGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004799.2-4749s21c1
Sequence:CCGGTCCGCTCCTCTCTCAAGATTTCTCGAGAAATCTTGAGAGAGGAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004799.2-1370s21c1
Sequence:CCGGACTAATTGGAAGTTGACTAAACTCGAGTTTAGTCAACTTCCAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004799.2-1077s21c1
Sequence:CCGGCAGATCTAGGGAGTCCAAATTCTCGAGAATTTGGACTCCCTAGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004799.2-1499s21c1
Sequence:CCGGGCAGATGCAGGTCTAGATTTACTCGAGTAAATCTAGACCTGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks