EMAIL THIS PAGE TO A FRIEND

ZG16

zymogen granule protein 16

Synonyms: JCLN JCLN1 ZG16A
UniProtKB ID: O60844, B2R4Z3, B9EK72
Gene ID:
Mouse(69036) zymogen granule protein 16
Rat(171449) zymogen granule protein 16
domestic cat(101095538) zymogen granule protein 16 homolog (rat)
dog(479782) zymogen granule protein 16 homolog (rat)
domestic guinea pig(100735412) zymogen granule protein 16
naked mole-rat(101717911) zymogen granule protein 16
cow(614681) zymogen granule protein 16
sheep(101102200) zymogen granule protein 16 homolog (rat)
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0307 AQUA Peptide FSHSGNQLDGPITAI[R] rat pricing
AQ0306 AQUA Peptide SSSYSGEYGG[K] rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU008261 MISSION® esiRNA esiRNA targeting mouse 1810010M01Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_930062 Rosetta Predictions human pricing
NM_134409 Rosetta Predictions rat pricing
NM_026918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278975 predicted 832
2 SASI_Hs02_00481215 predicted 863
3 SASI_Hs01_00278977 predicted 876
4 SASI_Hs02_00481216 predicted 985
5 SASI_Hs02_00481217 predicted 877
6 SASI_Hs02_00481218 predicted 985
7 SASI_Hs02_00481219 predicted 869
8 SASI_Hs02_00481220 predicted 861
9 SASI_Hs02_00481221 predicted 984
10 SASI_Hs02_00481222 predicted 902
11 SASI_Hs01_00278976 predicted 145
12 SASI_Hs01_00278978 predicted 180
13 SASI_Hs01_00278979 predicted 406
14 SASI_Hs01_00278980 predicted 598
15 SASI_Hs01_00278981 predicted 346
16 SASI_Hs01_00278982 predicted 428
17 SASI_Hs01_00278983 predicted 841
18 SASI_Hs01_00278984 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043473 predicted 423
2 SASI_Rn01_00043474 predicted 216
3 SASI_Rn01_00043475 predicted 369
4 SASI_Rn01_00043476 predicted 345
5 SASI_Rn01_00043477 predicted 220
6 SASI_Rn01_00043478 predicted 264
7 SASI_Rn01_00043479 predicted 423
8 SASI_Rn01_00043480 predicted 202
9 SASI_Rn01_00043481 predicted 224
10 SASI_Rn01_00043482 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331195 predicted 404
2 SASI_Mm01_00168876 predicted 206
3 SASI_Mm01_00168879 predicted 205
4 SASI_Mm01_00168882 predicted 219
5 SASI_Mm02_00331196 predicted 236
6 SASI_Mm01_00168884 predicted 404
7 SASI_Mm02_00331197 predicted 208
8 SASI_Mm02_00331198 predicted 202
9 SASI_Mm01_00168875 predicted 286
10 SASI_Mm01_00168877 predicted 376
11 SASI_Mm01_00168878 predicted 298
12 SASI_Mm01_00168880 predicted 383
13 SASI_Mm01_00168881 predicted 381
14 SASI_Mm01_00168883 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026918
ZG16 MISSION shRNA Bacterial Glycerol Stock
zymogen granule protein 16
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026918.2-108s1c1
Sequence:CCGGGAAAGCGATTCTCTCATTCTGCTCGAGCAGAATGAGAGAATCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026918.2-445s1c1
Sequence:CCGGCTCTGCCATAGATTCTATTAGCTCGAGCTAATAGAATCTATGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026918.1-82s1c1
Sequence:CCGGCAGTGGAGAGTATGGAGGTAACTCGAGTTACCTCCATACTCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026918.1-325s1c1
Sequence:CCGGGATGATCTTCGTGACGGACAACTCGAGTTGTCCGTCACGAAGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026918.1-166s1c1
Sequence:CCGGCCGGGTCAACAGATACTACATCTCGAGATGTAGTATCTGTTGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026918.1-91s1c1
Sequence:CCGGGTATGGAGGTAAAGGAGGAAACTCGAGTTTCCTCCTTTACCTCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026918.1-295s1c1
Sequence:CCGGGTCTGGCAAGTACAAATCATACTCGAGTATGATTTGTACTTGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026918
ZG16 MISSION shRNA shRNA Plasmid DNA
zymogen granule protein 16
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026918.2-108s1c1
Sequence:CCGGGAAAGCGATTCTCTCATTCTGCTCGAGCAGAATGAGAGAATCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026918.2-445s1c1
Sequence:CCGGCTCTGCCATAGATTCTATTAGCTCGAGCTAATAGAATCTATGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026918.1-82s1c1
Sequence:CCGGCAGTGGAGAGTATGGAGGTAACTCGAGTTACCTCCATACTCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026918.1-325s1c1
Sequence:CCGGGATGATCTTCGTGACGGACAACTCGAGTTGTCCGTCACGAAGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026918.1-166s1c1
Sequence:CCGGCCGGGTCAACAGATACTACATCTCGAGATGTAGTATCTGTTGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026918.1-91s1c1
Sequence:CCGGGTATGGAGGTAAAGGAGGAAACTCGAGTTTCCTCCTTTACCTCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026918.1-295s1c1
Sequence:CCGGGTCTGGCAAGTACAAATCATACTCGAGTATGATTTGTACTTGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026918
ZG16 MISSION shRNA Lentiviral Transduction Particles
zymogen granule protein 16
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026918.2-108s1c1
Sequence:CCGGGAAAGCGATTCTCTCATTCTGCTCGAGCAGAATGAGAGAATCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026918.2-445s1c1
Sequence:CCGGCTCTGCCATAGATTCTATTAGCTCGAGCTAATAGAATCTATGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026918.1-82s1c1
Sequence:CCGGCAGTGGAGAGTATGGAGGTAACTCGAGTTACCTCCATACTCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026918.1-325s1c1
Sequence:CCGGGATGATCTTCGTGACGGACAACTCGAGTTGTCCGTCACGAAGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026918.1-166s1c1
Sequence:CCGGCCGGGTCAACAGATACTACATCTCGAGATGTAGTATCTGTTGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026918.1-91s1c1
Sequence:CCGGGTATGGAGGTAAAGGAGGAAACTCGAGTTTCCTCCTTTACCTCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026918.1-295s1c1
Sequence:CCGGGTCTGGCAAGTACAAATCATACTCGAGTATGATTTGTACTTGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks