EMAIL THIS PAGE TO A FRIEND

ZG16B

zymogen granule protein 16B

Synonyms: EECP HRPE773 JCLN2 PAUF PRO1567
UniProtKB ID: Q96DA0, A6NIY1, B2R4F6, Q6UW28
Gene ID:
cow(100295741) zymogen granule protein 16B
naked mole-rat(101714708) zymogen granule protein 16B
dog(490055) zymogen granule protein 16 homolog B (rat)
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145252 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032091 MISSION® esiRNA esiRNA human AC005361.5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145252 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246204 predicted 477
2 SASI_Hs01_00246205 predicted 480
3 SASI_Hs01_00246207 predicted 567
4 SASI_Hs01_00246209 predicted 275
5 SASI_Hs02_00365102 predicted 573
6 SASI_Hs01_00246211 predicted 265
7 SASI_Hs01_00246212 predicted 383
8 SASI_Hs02_00365103 predicted 571
9 SASI_Hs02_00365104 predicted 432
10 SASI_Hs02_00365105 predicted 481
11 SASI_Hs01_00246206 predicted 610
12 SASI_Hs01_00246208 predicted 355
13 SASI_Hs01_00246210 predicted 314
14 SASI_Hs01_00246213 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145252
ZG16B MISSION shRNA Bacterial Glycerol Stock
zymogen granule protein 16B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-214s1c1
Sequence:CCGGCACTGAAGACTACGACCATGACTCGAGTCATGGTCGTAGTCTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-517s1c1
Sequence:CCGGCTATGGCCAGTATCAACTCCTCTCGAGAGGAGTTGATACTGGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-257s1c1
Sequence:CCGGGTAGGTCTTCTCCTGGTGAAACTCGAGTTTCACCAGGAGAAGACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-358s1c1
Sequence:CCGGGCCAGGCGAATACATCACAAACTCGAGTTTGTGATGTATTCGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-195s1c1
Sequence:CCGGGAGGCAAGTATTTCAGCACCACTCGAGTGGTGCTGAAATACTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-216s1c1
Sequence:CCGGCTGAAGACTACGACCATGAAACTCGAGTTTCATGGTCGTAGTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-221s1c1
Sequence:CCGGGACTACGACCATGAAATCACACTCGAGTGTGATTTCATGGTCGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-599s1c1
Sequence:CCGGCCAGTTAATCTCACATACTCACTCGAGTGAGTATGTGAGATTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-430s1c1
Sequence:CCGGCAAGGACCGCTATTTCTATTTCTCGAGAAATAGAAATAGCGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-429s1c1
Sequence:CCGGGCAAGGACCGCTATTTCTATTCTCGAGAATAGAAATAGCGGTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-595s1c1
Sequence:CCGGGCCACCAGTTAATCTCACATACTCGAGTATGTGAGATTAACTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-411s1c1
Sequence:CCGGGTATGGTCATGTACACCAGCACTCGAGTGCTGGTGTACATGACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145252
ZG16B MISSION shRNA shRNA Plasmid DNA
zymogen granule protein 16B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-214s1c1
Sequence:CCGGCACTGAAGACTACGACCATGACTCGAGTCATGGTCGTAGTCTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-517s1c1
Sequence:CCGGCTATGGCCAGTATCAACTCCTCTCGAGAGGAGTTGATACTGGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-257s1c1
Sequence:CCGGGTAGGTCTTCTCCTGGTGAAACTCGAGTTTCACCAGGAGAAGACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-358s1c1
Sequence:CCGGGCCAGGCGAATACATCACAAACTCGAGTTTGTGATGTATTCGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-195s1c1
Sequence:CCGGGAGGCAAGTATTTCAGCACCACTCGAGTGGTGCTGAAATACTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-216s1c1
Sequence:CCGGCTGAAGACTACGACCATGAAACTCGAGTTTCATGGTCGTAGTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-221s1c1
Sequence:CCGGGACTACGACCATGAAATCACACTCGAGTGTGATTTCATGGTCGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-599s1c1
Sequence:CCGGCCAGTTAATCTCACATACTCACTCGAGTGAGTATGTGAGATTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-430s1c1
Sequence:CCGGCAAGGACCGCTATTTCTATTTCTCGAGAAATAGAAATAGCGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-429s1c1
Sequence:CCGGGCAAGGACCGCTATTTCTATTCTCGAGAATAGAAATAGCGGTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-595s1c1
Sequence:CCGGGCCACCAGTTAATCTCACATACTCGAGTATGTGAGATTAACTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-411s1c1
Sequence:CCGGGTATGGTCATGTACACCAGCACTCGAGTGCTGGTGTACATGACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145252
ZG16B MISSION shRNA Lentiviral Transduction Particles
zymogen granule protein 16B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-214s1c1
Sequence:CCGGCACTGAAGACTACGACCATGACTCGAGTCATGGTCGTAGTCTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-517s1c1
Sequence:CCGGCTATGGCCAGTATCAACTCCTCTCGAGAGGAGTTGATACTGGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-257s1c1
Sequence:CCGGGTAGGTCTTCTCCTGGTGAAACTCGAGTTTCACCAGGAGAAGACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-358s1c1
Sequence:CCGGGCCAGGCGAATACATCACAAACTCGAGTTTGTGATGTATTCGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-195s1c1
Sequence:CCGGGAGGCAAGTATTTCAGCACCACTCGAGTGGTGCTGAAATACTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-216s1c1
Sequence:CCGGCTGAAGACTACGACCATGAAACTCGAGTTTCATGGTCGTAGTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-221s1c1
Sequence:CCGGGACTACGACCATGAAATCACACTCGAGTGTGATTTCATGGTCGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-599s1c1
Sequence:CCGGCCAGTTAATCTCACATACTCACTCGAGTGAGTATGTGAGATTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-430s1c1
Sequence:CCGGCAAGGACCGCTATTTCTATTTCTCGAGAAATAGAAATAGCGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-429s1c1
Sequence:CCGGGCAAGGACCGCTATTTCTATTCTCGAGAATAGAAATAGCGGTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-595s1c1
Sequence:CCGGGCCACCAGTTAATCTCACATACTCGAGTATGTGAGATTAACTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145252.1-411s1c1
Sequence:CCGGGTATGGTCATGTACACCAGCACTCGAGTGCTGGTGTACATGACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks