EMAIL THIS PAGE TO A FRIEND

ZGLP1

zinc finger, GATA-like protein 1

Synonyms: GATAD3 GLP-1 GLP1
UniProtKB ID: P0C6A0
Gene ID:
Mouse(100009600) zinc finger, GATA-like protein 1
Rat(100360291) zinc finger, GATA-like protein 1
Zebrafish(751739) zinc finger, GATA-like protein 1
domestic cat(101093997) zinc finger, GATA-like protein 1
dog(100684009) zinc finger, GATA-like protein 1
naked mole-rat(101714367) zinc finger, GATA-like protein 1
domestic guinea pig(100718801) zinc finger, GATA-like protein 1
cow(782656) zinc finger, GATA-like protein 1
sheep(101116986) zinc finger, GATA-like protein 1
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001103168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001103168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001103168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001103167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001103167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001103167 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU226171 MISSION® esiRNA esiRNA targeting human ZGLP1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001103167 Rosetta Predictions human pricing
NM_001103168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323623 predicted 1626
2 SASI_Hs02_00323624 predicted 1178
3 SASI_Hs02_00323625 predicted 1566
4 SASI_Hs02_00323626 predicted 1058
5 SASI_Hs02_00323627 predicted 1311
6 SASI_Hs02_00323628 predicted 1564
7 SASI_Hs02_00323629 predicted 897
8 SASI_Hs02_00323630 predicted 1178
9 SASI_Hs02_00323631 predicted 913
10 SASI_Hs02_00323632 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303154 predicted 396
2 SASI_Mm02_00303155 predicted 471
3 SASI_Mm02_00303156 predicted 397
4 SASI_Mm02_00303157 predicted 468
5 SASI_Mm02_00303158 predicted 402
6 SASI_Mm02_00303159 predicted 340
7 SASI_Mm02_00303160 predicted 270
8 SASI_Mm02_00303161 predicted 456
9 SASI_Mm02_00303162 predicted 464
10 SASI_Mm02_00303163 predicted 406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001103168
ZGLP1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, GATA-like protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103168.1-132s21c1
Sequence:CCGGAGATGCCTCACTCCCAATATCCTCGAGGATATTGGGAGTGAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103168.1-403s21c1
Sequence:CCGGTAAACCCGCGAATGGGTATTGCTCGAGCAATACCCATTCGCGGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103168.1-806s21c1
Sequence:CCGGGGAACTGTAAGCCCTTCTTTACTCGAGTAAAGAAGGGCTTACAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103168.1-291s21c1
Sequence:CCGGATGTCAGACCACCTGAGTATGCTCGAGCATACTCAGGTGGTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103168.1-833s21c1
Sequence:CCGGCAAGTCAGCTTTGTCTCAGTTCTCGAGAACTGAGACAAAGCTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001103168
ZGLP1 MISSION shRNA shRNA Plasmid DNA
zinc finger, GATA-like protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103168.1-132s21c1
Sequence:CCGGAGATGCCTCACTCCCAATATCCTCGAGGATATTGGGAGTGAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103168.1-403s21c1
Sequence:CCGGTAAACCCGCGAATGGGTATTGCTCGAGCAATACCCATTCGCGGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103168.1-806s21c1
Sequence:CCGGGGAACTGTAAGCCCTTCTTTACTCGAGTAAAGAAGGGCTTACAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103168.1-291s21c1
Sequence:CCGGATGTCAGACCACCTGAGTATGCTCGAGCATACTCAGGTGGTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103168.1-833s21c1
Sequence:CCGGCAAGTCAGCTTTGTCTCAGTTCTCGAGAACTGAGACAAAGCTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001103168
ZGLP1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, GATA-like protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103168.1-132s21c1
Sequence:CCGGAGATGCCTCACTCCCAATATCCTCGAGGATATTGGGAGTGAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103168.1-403s21c1
Sequence:CCGGTAAACCCGCGAATGGGTATTGCTCGAGCAATACCCATTCGCGGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103168.1-806s21c1
Sequence:CCGGGGAACTGTAAGCCCTTCTTTACTCGAGTAAAGAAGGGCTTACAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103168.1-291s21c1
Sequence:CCGGATGTCAGACCACCTGAGTATGCTCGAGCATACTCAGGTGGTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103168.1-833s21c1
Sequence:CCGGCAAGTCAGCTTTGTCTCAGTTCTCGAGAACTGAGACAAAGCTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001103167
ZGLP1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, GATA-like protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103167.1-1565s21c1
Sequence:CCGGGTGGGATCAGGTACAAGAAATCTCGAGATTTCTTGTACCTGATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103167.1-905s21c1
Sequence:CCGGCCTGTCCAAGGGTACACAAAGCTCGAGCTTTGTGTACCCTTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103167.1-960s21c1
Sequence:CCGGACCCAGGAGTCACCCAAGAAACTCGAGTTTCTTGGGTGACTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103167.1-1675s21c1
Sequence:CCGGCCCATTCAGGAAGGTTAAACCCTCGAGGGTTTAACCTTCCTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103167.1-1800s21c1
Sequence:CCGGCTCTCTGCCATCTCCAGATTCCTCGAGGAATCTGGAGATGGCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001103167
ZGLP1 MISSION shRNA shRNA Plasmid DNA
zinc finger, GATA-like protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103167.1-1565s21c1
Sequence:CCGGGTGGGATCAGGTACAAGAAATCTCGAGATTTCTTGTACCTGATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103167.1-905s21c1
Sequence:CCGGCCTGTCCAAGGGTACACAAAGCTCGAGCTTTGTGTACCCTTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103167.1-960s21c1
Sequence:CCGGACCCAGGAGTCACCCAAGAAACTCGAGTTTCTTGGGTGACTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103167.1-1675s21c1
Sequence:CCGGCCCATTCAGGAAGGTTAAACCCTCGAGGGTTTAACCTTCCTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103167.1-1800s21c1
Sequence:CCGGCTCTCTGCCATCTCCAGATTCCTCGAGGAATCTGGAGATGGCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001103167
ZGLP1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, GATA-like protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103167.1-1565s21c1
Sequence:CCGGGTGGGATCAGGTACAAGAAATCTCGAGATTTCTTGTACCTGATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103167.1-905s21c1
Sequence:CCGGCCTGTCCAAGGGTACACAAAGCTCGAGCTTTGTGTACCCTTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103167.1-960s21c1
Sequence:CCGGACCCAGGAGTCACCCAAGAAACTCGAGTTTCTTGGGTGACTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103167.1-1675s21c1
Sequence:CCGGCCCATTCAGGAAGGTTAAACCCTCGAGGGTTTAACCTTCCTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103167.1-1800s21c1
Sequence:CCGGCTCTCTGCCATCTCCAGATTCCTCGAGGAATCTGGAGATGGCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks