EMAIL THIS PAGE TO A FRIEND

ZGPAT

zinc finger, CCCH-type with G patch domain

Synonyms: GPATC6 GPATCH6 KIAA1847 ZC3H9 ZC3HDC9 ZIP
Gene ID:
Mouse(229007) zinc finger, CCCH-type with G patch domain
Rat(296478) zinc finger, CCCH-type with G patch domain
Zebrafish(393457) zinc finger, CCCH-type with G patch domain
chicken(419260) zinc finger, CCCH-type with G patch domain
domestic cat(101092923) zinc finger, CCCH-type with G patch domain
dog(100687731) zinc finger, CCCH-type with G patch domain
cow(510866) zinc finger, CCCH-type with G patch domain
sheep(100302028) zinc finger, CCCH-type with G patch domain
domestic guinea pig(100729595) zinc finger, CCCH-type with G patch domain
naked mole-rat(101725862) zinc finger, CCCH-type with G patch domain
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032527 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181484 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083113 Rosetta Predictions human pricing
NM_032527 Rosetta Predictions human pricing
NM_181484 Rosetta Predictions human pricing
NM_181485 Rosetta Predictions human pricing
NM_001009656 Rosetta Predictions rat pricing
NM_001048148 Rosetta Predictions mouse pricing
NM_144894 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316864 predicted 1311
2 SASI_Hs02_00316865 predicted 1326
3 SASI_Hs02_00316866 predicted 1318
4 SASI_Hs02_00316867 predicted 1641
5 SASI_Hs02_00316868 predicted 1477
6 SASI_Hs02_00316869 predicted 722
7 SASI_Hs02_00316870 predicted 439
8 SASI_Hs02_00316871 predicted 693
9 SASI_Hs02_00316872 predicted 1101
10 SASI_Hs02_00316873 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093769 predicted 1405
2 SASI_Hs01_00093770 predicted 1415
3 SASI_Hs01_00093771 predicted 1412
4 SASI_Hs01_00093772 predicted 1734
5 SASI_Hs01_00093773 predicted 1573
6 SASI_Hs01_00093775 predicted 754
7 SASI_Hs01_00093776 predicted 466
8 SASI_Hs01_00093777 predicted 723
9 SASI_Hs01_00093778 predicted 1198
10 SASI_Hs02_00360026 predicted 1256
11 SASI_Hs01_00093774 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044634 predicted 691
2 SASI_Hs01_00044635 predicted 405
3 SASI_Hs01_00044636 predicted 662
4 SASI_Hs01_00044637 predicted 1053
5 SASI_Hs01_00044638 predicted 1162
6 SASI_Hs01_00044639 predicted 960
7 SASI_Hs01_00044640 predicted 1059
8 SASI_Hs01_00044641 predicted 1543
9 SASI_Hs01_00044642 predicted 1518
10 SASI_Hs01_00044643 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173186 predicted 1284
2 SASI_Hs01_00173187 predicted 1294
3 SASI_Hs01_00173188 predicted 1292
4 SASI_Hs01_00173189 predicted 1616
5 SASI_Hs01_00173190 predicted 1448
6 SASI_Hs01_00173192 predicted 698
7 SASI_Hs01_00173193 predicted 413
8 SASI_Hs01_00173194 predicted 671
9 SASI_Hs01_00173195 predicted 1077
10 SASI_Hs02_00370103 predicted 1139
11 SASI_Hs01_00173191 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053437 predicted 753
2 SASI_Rn02_00199684 predicted 557
3 SASI_Rn01_00053439 predicted 675
4 SASI_Rn01_00053440 predicted 835
5 SASI_Rn01_00053441 predicted 1380
6 SASI_Rn01_00053442 predicted 1093
7 SASI_Rn01_00053443 predicted 1080
8 SASI_Rn02_00199685 predicted 1631
9 SASI_Rn01_00053444 predicted 1423
10 SASI_Rn01_00053445 predicted 850
11 SASI_Rn01_00053438 predicted 360
12 SASI_Rn01_00053446 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292081 predicted 975
2 SASI_Mm02_00292082 predicted 984
3 SASI_Mm02_00292083 predicted 955
4 SASI_Mm02_00292084 predicted 1217
5 SASI_Mm02_00292085 predicted 1210
6 SASI_Mm02_00292086 predicted 472
7 SASI_Mm02_00292087 predicted 1506
8 SASI_Mm02_00292088 predicted 1541
9 SASI_Mm02_00292089 predicted 881
10 SASI_Mm02_00292090 predicted 1823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108070 predicted 1194
2 SASI_Mm01_00108071 predicted 1200
3 SASI_Mm01_00108073 predicted 1184
4 SASI_Mm01_00108074 predicted 1441
5 SASI_Mm01_00108075 predicted 1431
6 SASI_Mm01_00108076 predicted 697
7 SASI_Mm01_00108077 predicted 1722
8 SASI_Mm01_00108078 predicted 1767
9 SASI_Mm01_00108079 predicted 1099
10 SASI_Mm02_00340351 predicted 2049
11 SASI_Mm01_00108072 predicted 604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144894
VALIDATED
ZGPAT MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCCH-type with G patch domain
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144894.3-963s21c1
Sequence:CCGGGTCCGAGTCCTCTACCTATACCTCGAGGTATAGGTAGAGGACTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144894.3-1438s21c1
Sequence:CCGGTCAAGATGGGCTATGAGTTTGCTCGAGCAAACTCATAGCCCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144894.3-1209s21c1
Sequence:CCGGACCGTTAAGTTTGACTCATTGCTCGAGCAATGAGTCAAACTTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144894.3-2076s21c1
Sequence:CCGGCTGTCACCCTGATGCCTAAACCTCGAGGTTTAGGCATCAGGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144894.3-850s21c1
Sequence:CCGGAGGAACTGAGCGGTGCTAAAGCTCGAGCTTTAGCACCGCTCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144894.2-910s1c1
Sequence:CCGGGAGTATCACAACGCTATGGTACTCGAGTACCATAGCGTTGTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144894.2-1099s1c1
Sequence:CCGGCCCTTTCAGGATCCAGACTTACTCGAGTAAGTCTGGATCCTGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144894.2-1183s1c1
Sequence:CCGGCGGATCACTGATGTGGACAATCTCGAGATTGTCCACATCAGTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144894.2-600s1c1
Sequence:CCGGCGATCTAAAGGAGCTGATTGACTCGAGTCAATCAGCTCCTTTAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144894
VALIDATED
ZGPAT MISSION shRNA shRNA Plasmid DNA
zinc finger, CCCH-type with G patch domain
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144894.3-963s21c1
Sequence:CCGGGTCCGAGTCCTCTACCTATACCTCGAGGTATAGGTAGAGGACTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144894.3-1438s21c1
Sequence:CCGGTCAAGATGGGCTATGAGTTTGCTCGAGCAAACTCATAGCCCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144894.3-1209s21c1
Sequence:CCGGACCGTTAAGTTTGACTCATTGCTCGAGCAATGAGTCAAACTTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144894.3-2076s21c1
Sequence:CCGGCTGTCACCCTGATGCCTAAACCTCGAGGTTTAGGCATCAGGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144894.3-850s21c1
Sequence:CCGGAGGAACTGAGCGGTGCTAAAGCTCGAGCTTTAGCACCGCTCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144894.2-910s1c1
Sequence:CCGGGAGTATCACAACGCTATGGTACTCGAGTACCATAGCGTTGTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144894.2-1099s1c1
Sequence:CCGGCCCTTTCAGGATCCAGACTTACTCGAGTAAGTCTGGATCCTGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144894.2-1183s1c1
Sequence:CCGGCGGATCACTGATGTGGACAATCTCGAGATTGTCCACATCAGTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144894.2-600s1c1
Sequence:CCGGCGATCTAAAGGAGCTGATTGACTCGAGTCAATCAGCTCCTTTAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144894
VALIDATED
ZGPAT MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCCH-type with G patch domain
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144894.3-963s21c1
Sequence:CCGGGTCCGAGTCCTCTACCTATACCTCGAGGTATAGGTAGAGGACTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144894.3-1438s21c1
Sequence:CCGGTCAAGATGGGCTATGAGTTTGCTCGAGCAAACTCATAGCCCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144894.3-1209s21c1
Sequence:CCGGACCGTTAAGTTTGACTCATTGCTCGAGCAATGAGTCAAACTTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144894.3-2076s21c1
Sequence:CCGGCTGTCACCCTGATGCCTAAACCTCGAGGTTTAGGCATCAGGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144894.3-850s21c1
Sequence:CCGGAGGAACTGAGCGGTGCTAAAGCTCGAGCTTTAGCACCGCTCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144894.2-910s1c1
Sequence:CCGGGAGTATCACAACGCTATGGTACTCGAGTACCATAGCGTTGTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144894.2-1099s1c1
Sequence:CCGGCCCTTTCAGGATCCAGACTTACTCGAGTAAGTCTGGATCCTGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144894.2-1183s1c1
Sequence:CCGGCGGATCACTGATGTGGACAATCTCGAGATTGTCCACATCAGTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144894.2-600s1c1
Sequence:CCGGCGATCTAAAGGAGCTGATTGACTCGAGTCAATCAGCTCCTTTAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032527
VALIDATED
ZGPAT MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCCH-type with G patch domain
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032527.3-557s21c1
Sequence:CCGGGAAGAGCTGAGTGGGACAAAGCTCGAGCTTTGTCCCACTCAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032527.3-909s21c1
Sequence:CCGGGCTACTACACAGTCAAGTTTGCTCGAGCAAACTTGACTGTGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032527.3-1203s21c1
Sequence:CCGGCCAAGATGGGCTATGAGTTTGCTCGAGCAAACTCATAGCCCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032527.3-731s21c1
Sequence:CCGGGAGGGAAAGTGCCGCTTTAAGCTCGAGCTTAAAGCGGCACTTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032527.3-1780s21c1
Sequence:CCGGCCACAAGCACTATGGACGAAGCTCGAGCTTCGTCCATAGTGCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1749s1c1
Sequence:CCGGCCCACAAGAAGATGACTGAGTCTCGAGACTCAGTCATCTTCTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-916s1c1
Sequence:CCGGCACAGTCAAGTTTGACTCGCTCTCGAGAGCGAGTCAAACTTGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1212s1c1
Sequence:CCGGGCTATGAGTTTGGCAAGGGTTCTCGAGAACCCTTGCCAAACTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-904s1c1
Sequence:CCGGCAACGGCTACTACACAGTCAACTCGAGTTGACTGTGTAGTAGCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1418s1c1
Sequence:CCGGGTGTTTGACTTCCTCAATGAACTCGAGTTCATTGAGGAAGTCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032527.2-1414s1c1
Sequence:CCGGGAATGTGTTTGACTTCCTCAACTCGAGTTGAGGAAGTCAAACACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1753s1c1
Sequence:CCGGCAAGAAGATGACTGAGTTCTACTCGAGTAGAACTCAGTCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032527.2-1213s1c1
Sequence:CCGGCTATGAGTTTGGCAAGGGTTTCTCGAGAAACCCTTGCCAAACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1750s1c1
Sequence:CCGGCCACAAGAAGATGACTGAGTTCTCGAGAACTCAGTCATCTTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032527
VALIDATED
ZGPAT MISSION shRNA shRNA Plasmid DNA
zinc finger, CCCH-type with G patch domain
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032527.3-557s21c1
Sequence:CCGGGAAGAGCTGAGTGGGACAAAGCTCGAGCTTTGTCCCACTCAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032527.3-909s21c1
Sequence:CCGGGCTACTACACAGTCAAGTTTGCTCGAGCAAACTTGACTGTGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032527.3-1203s21c1
Sequence:CCGGCCAAGATGGGCTATGAGTTTGCTCGAGCAAACTCATAGCCCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032527.3-731s21c1
Sequence:CCGGGAGGGAAAGTGCCGCTTTAAGCTCGAGCTTAAAGCGGCACTTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032527.3-1780s21c1
Sequence:CCGGCCACAAGCACTATGGACGAAGCTCGAGCTTCGTCCATAGTGCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1749s1c1
Sequence:CCGGCCCACAAGAAGATGACTGAGTCTCGAGACTCAGTCATCTTCTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-916s1c1
Sequence:CCGGCACAGTCAAGTTTGACTCGCTCTCGAGAGCGAGTCAAACTTGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1212s1c1
Sequence:CCGGGCTATGAGTTTGGCAAGGGTTCTCGAGAACCCTTGCCAAACTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-904s1c1
Sequence:CCGGCAACGGCTACTACACAGTCAACTCGAGTTGACTGTGTAGTAGCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1418s1c1
Sequence:CCGGGTGTTTGACTTCCTCAATGAACTCGAGTTCATTGAGGAAGTCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032527.2-1414s1c1
Sequence:CCGGGAATGTGTTTGACTTCCTCAACTCGAGTTGAGGAAGTCAAACACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1753s1c1
Sequence:CCGGCAAGAAGATGACTGAGTTCTACTCGAGTAGAACTCAGTCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032527.2-1213s1c1
Sequence:CCGGCTATGAGTTTGGCAAGGGTTTCTCGAGAAACCCTTGCCAAACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1750s1c1
Sequence:CCGGCCACAAGAAGATGACTGAGTTCTCGAGAACTCAGTCATCTTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032527
VALIDATED
ZGPAT MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCCH-type with G patch domain
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032527.3-557s21c1
Sequence:CCGGGAAGAGCTGAGTGGGACAAAGCTCGAGCTTTGTCCCACTCAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032527.3-909s21c1
Sequence:CCGGGCTACTACACAGTCAAGTTTGCTCGAGCAAACTTGACTGTGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032527.3-1203s21c1
Sequence:CCGGCCAAGATGGGCTATGAGTTTGCTCGAGCAAACTCATAGCCCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032527.3-731s21c1
Sequence:CCGGGAGGGAAAGTGCCGCTTTAAGCTCGAGCTTAAAGCGGCACTTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032527.3-1780s21c1
Sequence:CCGGCCACAAGCACTATGGACGAAGCTCGAGCTTCGTCCATAGTGCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1749s1c1
Sequence:CCGGCCCACAAGAAGATGACTGAGTCTCGAGACTCAGTCATCTTCTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-916s1c1
Sequence:CCGGCACAGTCAAGTTTGACTCGCTCTCGAGAGCGAGTCAAACTTGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1212s1c1
Sequence:CCGGGCTATGAGTTTGGCAAGGGTTCTCGAGAACCCTTGCCAAACTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-904s1c1
Sequence:CCGGCAACGGCTACTACACAGTCAACTCGAGTTGACTGTGTAGTAGCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1418s1c1
Sequence:CCGGGTGTTTGACTTCCTCAATGAACTCGAGTTCATTGAGGAAGTCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032527.2-1414s1c1
Sequence:CCGGGAATGTGTTTGACTTCCTCAACTCGAGTTGAGGAAGTCAAACACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1753s1c1
Sequence:CCGGCAAGAAGATGACTGAGTTCTACTCGAGTAGAACTCAGTCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032527.2-1213s1c1
Sequence:CCGGCTATGAGTTTGGCAAGGGTTTCTCGAGAAACCCTTGCCAAACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032527.2-1750s1c1
Sequence:CCGGCCACAAGAAGATGACTGAGTTCTCGAGAACTCAGTCATCTTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181484
ZGPAT MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCCH-type with G patch domain
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000166365    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181484.1-1447s1c1
Sequence:CCGGCGTGTGCGTGTGTGTGTATATCTCGAGATATACACACACACGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181484
ZGPAT MISSION shRNA shRNA Plasmid DNA
zinc finger, CCCH-type with G patch domain
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000166365    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181484.1-1447s1c1
Sequence:CCGGCGTGTGCGTGTGTGTGTATATCTCGAGATATACACACACACGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181484
ZGPAT MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCCH-type with G patch domain
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000166365    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181484.1-1447s1c1
Sequence:CCGGCGTGTGCGTGTGTGTGTATATCTCGAGATATACACACACACGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks