EMAIL THIS PAGE TO A FRIEND

ZHX1

zinc fingers and homeoboxes 1

UniProtKB ID: Q9UKY1, Q8IWD8
Gene ID:
Human(11244) Summary: The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 1 of this gene family. In addition to forming homodimers, this protein heterodimerizes with members 2 and 3 of the zinc fingers and homeoboxes family. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream chromosome 8 open reading frame 76 (C8orf76) gene. [provided by RefSeq, Feb 2011]
Mouse(22770) zinc fingers and homeoboxes 1
Rat(171159) zinc fingers and homeoboxes 1
chicken(420347) zinc fingers and homeoboxes 1
domestic cat(101101363) zinc fingers and homeoboxes 1
dog(475089) zinc fingers and homeoboxes 1
domestic guinea pig(100726465) zinc fingers and homeoboxes 1
naked mole-rat(101719781) zinc fingers and homeoboxes 1
cow(782847) zinc fingers and homeoboxes 1
sheep(101108317) zinc fingers and homeoboxes 1
171 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007222 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017926 Rosetta Predictions human pricing
NM_007222 Rosetta Predictions human pricing
NM_133620 Rosetta Predictions rat pricing
NM_001042438 Rosetta Predictions mouse pricing
NM_009572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030812 predicted 2706
2 SASI_Hs01_00030813 predicted 2947
3 SASI_Hs01_00030814 predicted 1423
4 SASI_Hs01_00030815 predicted 1384
5 SASI_Hs01_00030816 predicted 2031
6 SASI_Hs01_00030817 predicted 3200
7 SASI_Hs01_00030818 predicted 653
8 SASI_Hs01_00030819 predicted 2988
9 SASI_Hs01_00030820 predicted 2352
10 SASI_Hs01_00030821 predicted 2090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068879 predicted 2610
2 SASI_Hs01_00068880 predicted 2853
3 SASI_Hs01_00068881 predicted 1330
4 SASI_Hs01_00068882 predicted 1289
5 SASI_Hs01_00068883 predicted 1933
6 SASI_Hs01_00068884 predicted 3106
7 SASI_Hs01_00068885 predicted 558
8 SASI_Hs01_00068886 predicted 2893
9 SASI_Hs01_00068887 predicted 2255
10 SASI_Hs01_00068888 predicted 2000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075162 predicted 1865
2 SASI_Rn01_00075163 predicted 1968
3 SASI_Rn01_00075164 predicted 2222
4 SASI_Rn01_00075165 predicted 1485
5 SASI_Rn02_00267847 predicted 534
6 SASI_Rn01_00075166 predicted 1289
7 SASI_Rn01_00075167 predicted 1248
8 SASI_Rn01_00075169 predicted 2820
9 SASI_Rn01_00075170 predicted 3045
10 SASI_Rn01_00075171 predicted 800
11 SASI_Rn01_00075168 predicted 2152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290375 predicted 2703
2 SASI_Mm02_00290376 predicted 1806
3 SASI_Mm02_00290377 predicted 1238
4 SASI_Mm02_00290378 predicted 1665
5 SASI_Mm02_00290379 predicted 3227
6 SASI_Mm02_00290380 predicted 2625
7 SASI_Mm02_00290381 predicted 1892
8 SASI_Mm02_00290382 predicted 2565
9 SASI_Mm02_00290383 predicted 2906
10 SASI_Mm02_00290384 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316453 predicted 2573
2 SASI_Mm02_00316454 predicted 1674
3 SASI_Mm02_00316455 predicted 1106
4 SASI_Mm02_00316456 predicted 1532
5 SASI_Mm02_00316457 predicted 3100
6 SASI_Mm02_00316458 predicted 2502
7 SASI_Mm02_00316459 predicted 1767
8 SASI_Mm02_00316460 predicted 2436
9 SASI_Mm02_00316461 predicted 2774
10 SASI_Mm02_00316462 predicted 1089
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009572
VALIDATED
ZHX1 MISSION shRNA Bacterial Glycerol Stock
zinc fingers and homeoboxes 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009572.2-2752s1c1
Sequence:CCGGGATCTGAGTTAGGTATAGAATCTCGAGATTCTATACCTAACTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009572.2-693s1c1
Sequence:CCGGCGGAATAACCAGACAATCTTTCTCGAGAAAGATTGTCTGGTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009572.2-1155s1c1
Sequence:CCGGGCATTGGATAACAATCCTCTTCTCGAGAAGAGGATTGTTATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009572.2-2380s1c1
Sequence:CCGGCCAGAACAGATATAGTTAGTTCTCGAGAACTAACTATATCTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009572.2-1786s1c1
Sequence:CCGGGCCTTACCAAAGGCGAGATTACTCGAGTAATCTCGCCTTTGGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009572.3-3499s21c1
Sequence:CCGGATGTATATAGAGCGCTAATTACTCGAGTAATTAGCGCTCTATATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009572.3-1077s21c1
Sequence:CCGGGACTATGGTGAAGCGGAATAACTCGAGTTATTCCGCTTCACCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009572.3-1552s21c1
Sequence:CCGGGCATTGGATAACAATCCTCTTCTCGAGAAGAGGATTGTTATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009572.3-2777s21c1
Sequence:CCGGCCAGAACAGATATAGTTAGTTCTCGAGAACTAACTATATCTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009572.3-1198s21c1
Sequence:CCGGTCGGGAATCTCCATTAGTAAACTCGAGTTTACTAATGGAGATTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009572
VALIDATED
ZHX1 MISSION shRNA shRNA Plasmid DNA
zinc fingers and homeoboxes 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009572.2-2752s1c1
Sequence:CCGGGATCTGAGTTAGGTATAGAATCTCGAGATTCTATACCTAACTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009572.2-693s1c1
Sequence:CCGGCGGAATAACCAGACAATCTTTCTCGAGAAAGATTGTCTGGTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009572.2-1155s1c1
Sequence:CCGGGCATTGGATAACAATCCTCTTCTCGAGAAGAGGATTGTTATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009572.2-2380s1c1
Sequence:CCGGCCAGAACAGATATAGTTAGTTCTCGAGAACTAACTATATCTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009572.2-1786s1c1
Sequence:CCGGGCCTTACCAAAGGCGAGATTACTCGAGTAATCTCGCCTTTGGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009572.3-3499s21c1
Sequence:CCGGATGTATATAGAGCGCTAATTACTCGAGTAATTAGCGCTCTATATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009572.3-1077s21c1
Sequence:CCGGGACTATGGTGAAGCGGAATAACTCGAGTTATTCCGCTTCACCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009572.3-1552s21c1
Sequence:CCGGGCATTGGATAACAATCCTCTTCTCGAGAAGAGGATTGTTATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009572.3-2777s21c1
Sequence:CCGGCCAGAACAGATATAGTTAGTTCTCGAGAACTAACTATATCTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009572.3-1198s21c1
Sequence:CCGGTCGGGAATCTCCATTAGTAAACTCGAGTTTACTAATGGAGATTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009572
VALIDATED
ZHX1 MISSION shRNA Lentiviral Transduction Particles
zinc fingers and homeoboxes 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009572.2-2752s1c1
Sequence:CCGGGATCTGAGTTAGGTATAGAATCTCGAGATTCTATACCTAACTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009572.2-693s1c1
Sequence:CCGGCGGAATAACCAGACAATCTTTCTCGAGAAAGATTGTCTGGTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009572.2-1155s1c1
Sequence:CCGGGCATTGGATAACAATCCTCTTCTCGAGAAGAGGATTGTTATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009572.2-2380s1c1
Sequence:CCGGCCAGAACAGATATAGTTAGTTCTCGAGAACTAACTATATCTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009572.2-1786s1c1
Sequence:CCGGGCCTTACCAAAGGCGAGATTACTCGAGTAATCTCGCCTTTGGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009572.3-3499s21c1
Sequence:CCGGATGTATATAGAGCGCTAATTACTCGAGTAATTAGCGCTCTATATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009572.3-1077s21c1
Sequence:CCGGGACTATGGTGAAGCGGAATAACTCGAGTTATTCCGCTTCACCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009572.3-1552s21c1
Sequence:CCGGGCATTGGATAACAATCCTCTTCTCGAGAAGAGGATTGTTATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009572.3-2777s21c1
Sequence:CCGGCCAGAACAGATATAGTTAGTTCTCGAGAACTAACTATATCTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009572.3-1198s21c1
Sequence:CCGGTCGGGAATCTCCATTAGTAAACTCGAGTTTACTAATGGAGATTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007222
VALIDATED
ZHX1 MISSION shRNA Bacterial Glycerol Stock
zinc fingers and homeoboxes 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-2055s1c1
Sequence:CCGGCCAGTGATGAAACCACGGAATCTCGAGATTCCGTGGTTTCATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-1019s1c1
Sequence:CCGGGCAGTTCATCATAACTCAGTTCTCGAGAACTGAGTTATGATGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-1935s1c1
Sequence:CCGGGCCTGACGAAAGGAGAGATTACTCGAGTAATCTCTCCTTTCGTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-2614s1c1
Sequence:CCGGCGCCAATTCAAGTAGTATGAACTCGAGTTCATACTACTTGAATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-1520s1c1
Sequence:CCGGCCTCAGACCATAACTGTTATTCTCGAGAATAACAGTTATGGTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007222.3-3418s21c1
Sequence:CCGGTCTAGTAAGATGGGCTATATACTCGAGTATATAGCCCATCTTACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007222.3-2775s21c1
Sequence:CCGGCTGCAATACTTAAGGATTATTCTCGAGAATAATCCTTAAGTATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007222.3-1562s21c1
Sequence:CCGGAGTAATGGTTTACCATCTATTCTCGAGAATAGATGGTAAACCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007222.3-950s21c1
Sequence:CCGGTCGGGAATATCTATCAGTAAACTCGAGTTTACTGATAGATATTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007222.3-829s21c1
Sequence:CCGGGACTATGGTGAAACGTAATAACTCGAGTTATTACGTTTCACCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007222
VALIDATED
ZHX1 MISSION shRNA shRNA Plasmid DNA
zinc fingers and homeoboxes 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-2055s1c1
Sequence:CCGGCCAGTGATGAAACCACGGAATCTCGAGATTCCGTGGTTTCATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-1019s1c1
Sequence:CCGGGCAGTTCATCATAACTCAGTTCTCGAGAACTGAGTTATGATGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-1935s1c1
Sequence:CCGGGCCTGACGAAAGGAGAGATTACTCGAGTAATCTCTCCTTTCGTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-2614s1c1
Sequence:CCGGCGCCAATTCAAGTAGTATGAACTCGAGTTCATACTACTTGAATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-1520s1c1
Sequence:CCGGCCTCAGACCATAACTGTTATTCTCGAGAATAACAGTTATGGTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007222.3-3418s21c1
Sequence:CCGGTCTAGTAAGATGGGCTATATACTCGAGTATATAGCCCATCTTACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007222.3-2775s21c1
Sequence:CCGGCTGCAATACTTAAGGATTATTCTCGAGAATAATCCTTAAGTATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007222.3-1562s21c1
Sequence:CCGGAGTAATGGTTTACCATCTATTCTCGAGAATAGATGGTAAACCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007222.3-950s21c1
Sequence:CCGGTCGGGAATATCTATCAGTAAACTCGAGTTTACTGATAGATATTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007222.3-829s21c1
Sequence:CCGGGACTATGGTGAAACGTAATAACTCGAGTTATTACGTTTCACCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007222
VALIDATED
ZHX1 MISSION shRNA Lentiviral Transduction Particles
zinc fingers and homeoboxes 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-2055s1c1
Sequence:CCGGCCAGTGATGAAACCACGGAATCTCGAGATTCCGTGGTTTCATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-1019s1c1
Sequence:CCGGGCAGTTCATCATAACTCAGTTCTCGAGAACTGAGTTATGATGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-1935s1c1
Sequence:CCGGGCCTGACGAAAGGAGAGATTACTCGAGTAATCTCTCCTTTCGTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-2614s1c1
Sequence:CCGGCGCCAATTCAAGTAGTATGAACTCGAGTTCATACTACTTGAATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007222.2-1520s1c1
Sequence:CCGGCCTCAGACCATAACTGTTATTCTCGAGAATAACAGTTATGGTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007222.3-3418s21c1
Sequence:CCGGTCTAGTAAGATGGGCTATATACTCGAGTATATAGCCCATCTTACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007222.3-2775s21c1
Sequence:CCGGCTGCAATACTTAAGGATTATTCTCGAGAATAATCCTTAAGTATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007222.3-1562s21c1
Sequence:CCGGAGTAATGGTTTACCATCTATTCTCGAGAATAGATGGTAAACCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007222.3-950s21c1
Sequence:CCGGTCGGGAATATCTATCAGTAAACTCGAGTTTACTGATAGATATTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007222.3-829s21c1
Sequence:CCGGGACTATGGTGAAACGTAATAACTCGAGTTATTACGTTTCACCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks