EMAIL THIS PAGE TO A FRIEND

ZHX2

zinc fingers and homeoboxes 2

Synonyms: AFR1 RAF
UniProtKB ID: Q9Y6X8
Gene ID:
Human(22882) Summary: The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 2 of this gene family. In addition to forming homodimers, this protein heterodimerizes with member 1 of the zinc fingers and homeoboxes family. [provided by RefSeq, Jul 2008]
Mouse(387609) zinc fingers and homeoboxes 2
Rat(314988) zinc fingers and homeoboxes 2
Zebrafish(386660) zinc-fingers and homeoboxes 2
Horse(100066952) zinc fingers and homeoboxes 2
domestic cat(101099936) zinc fingers and homeoboxes 2
chicken(420351) zinc fingers and homeoboxes 2
dog(482033) zinc fingers and homeoboxes 2
cow(515040) zinc fingers and homeoboxes 2
sheep(101109810) zinc fingers and homeoboxes 2
naked mole-rat(101723521) zinc fingers and homeoboxes 2
domestic guinea pig(100727933) zinc fingers and homeoboxes 2
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C7365 Anti-phospho-c-Raf (pSer338/pTyr340) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
western blot pricing
R1151 Anti-phospho-c-Raf (pSer621) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution, 10 blots human, rat, mouse
microarray, western blot pricing
AV39156 Anti-ZHX2 (AB1) antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, human, rabbit, canine, horse
western blot pricing
AV37629 Anti-ZHX2 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, horse, human, canine, rat, rabbit
western blot pricing
SAB1407157 Anti-ZHX2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA006769 Anti-ZHX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA006996 Anti-ZHX2 antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4500906 Anti-ZHX2, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
WH0022882M1 Monoclonal Anti-ZHX2 antibody produced in mouse clone 5E2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014943 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014943 Rosetta Predictions human pricing
XM_001067896 Rosetta Predictions rat pricing
XM_235318 Rosetta Predictions rat pricing
NM_199449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161286 predicted 906
2 SASI_Hs01_00161287 predicted 1292
3 SASI_Hs01_00161288 predicted 2572
4 SASI_Hs01_00161289 predicted 1146
5 SASI_Hs01_00161290 predicted 2323
6 SASI_Hs01_00161291 predicted 2125
7 SASI_Hs01_00161292 predicted 2006
8 SASI_Hs01_00161293 predicted 1376
9 SASI_Hs01_00161294 predicted 1307
10 SASI_Hs02_00346616 predicted 983
11 SASI_Hs01_00161285 predicted 2691
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322756 predicted 1042
2 SASI_Rn02_00322757 predicted 830
3 SASI_Rn02_00322758 predicted 952
4 SASI_Rn02_00322759 predicted 1159
5 SASI_Rn02_00322760 predicted 2623
6 SASI_Rn02_00322761 predicted 1322
7 SASI_Rn02_00322762 predicted 2434
8 SASI_Rn02_00322763 predicted 1524
9 SASI_Rn02_00322764 predicted 664
10 SASI_Rn02_00322765 predicted 2312
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389167 predicted 2699
2 SASI_Rn02_00389168 predicted 3266
3 SASI_Rn02_00389169 predicted 2009
4 SASI_Rn02_00389170 predicted 2629
5 SASI_Rn02_00389171 predicted 1975
6 SASI_Rn02_00389172 predicted 2858
7 SASI_Rn02_00389173 predicted 2333
8 SASI_Rn02_00389174 predicted 2179
9 SASI_Rn02_00389175 predicted 2441
10 SASI_Rn02_00389176 predicted 2787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020116 predicted 949
2 SASI_Mm01_00020117 predicted 940
3 SASI_Mm01_00020118 predicted 1018
4 SASI_Mm01_00020119 predicted 1035
5 SASI_Mm01_00020120 predicted 1044
6 SASI_Mm02_00351470 predicted 2922
7 SASI_Mm01_00020121 predicted 1393
8 SASI_Mm01_00020122 predicted 2327
9 SASI_Mm01_00020123 predicted 2625
10 SASI_Mm01_00020124 predicted 2861
11 SASI_Mm01_00020125 predicted 2338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014943
VALIDATED
ZHX2 MISSION shRNA Bacterial Glycerol Stock
zinc fingers and homeoboxes 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-2738s21c1
Sequence:CCGGGTGATGTGGTTCCACAATATTCTCGAGAATATTGTGGAACCACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-740s21c1
Sequence:CCGGACGAAGTGATAGAGGTGAAATCTCGAGATTTCACCTCTATCACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014943.3-3359s21c1
Sequence:CCGGTGCTATACTGGAACCGATTTGCTCGAGCAAATCGGTTCCAGTATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014943.3-3184s21c1
Sequence:CCGGACTCCAAGTGGAACTACTTAGCTCGAGCTAAGTAGTTCCACTTGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-2132s21c1
Sequence:CCGGATCATGCGTACCCAGACTTTGCTCGAGCAAAGTCTGGGTACGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-2023s21c1
Sequence:CCGGTGGTTCAGTGACCACCGATATCTCGAGATATCGGTGGTCACTGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-1390s21c1
Sequence:CCGGGCCACGATGATCAACTCTTTCCTCGAGGAAAGAGTTGATCATCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-863s21c1
Sequence:CCGGTGCAGCATCCCAACGTGATTCCTCGAGGAATCACGTTGGGATGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-1096s21c1
Sequence:CCGGTCTGGGATCTCGGTGAGTAAACTCGAGTTTACTCACCGAGATCCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-2926s21c1
Sequence:CCGGGAGTCGAGCGTTGTGGATTACCTCGAGGTAATCCACAACGCTCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-1494s21c1
Sequence:CCGGGTTTGCCACCCAGCGCTTAAACTCGAGTTTAAGCGCTGGGTGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_014943.2-1259s1c1
Sequence:CCGGCCCACTAAATACTACCAAATACTCGAGTATTTGGTAGTATTTAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014943.2-519s1c1
Sequence:CCGGCGGACATCACAAGTAGTAGAACTCGAGTTCTACTACTTGTGATGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014943.2-2887s1c1
Sequence:CCGGCGATCTCAGATAGATCAGATACTCGAGTATCTGATCTATCTGAGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014943.2-701s1c1
Sequence:CCGGCCAAGGTGGTTATGAGTGCAACTCGAGTTGCACTCATAACCACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014943.2-2599s1c1
Sequence:CCGGCCGTAGCAAGGAAAGCAACAACTCGAGTTGTTGCTTTCCTTGCTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014943
VALIDATED
ZHX2 MISSION shRNA shRNA Plasmid DNA
zinc fingers and homeoboxes 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-2738s21c1
Sequence:CCGGGTGATGTGGTTCCACAATATTCTCGAGAATATTGTGGAACCACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-740s21c1
Sequence:CCGGACGAAGTGATAGAGGTGAAATCTCGAGATTTCACCTCTATCACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014943.3-3359s21c1
Sequence:CCGGTGCTATACTGGAACCGATTTGCTCGAGCAAATCGGTTCCAGTATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014943.3-3184s21c1
Sequence:CCGGACTCCAAGTGGAACTACTTAGCTCGAGCTAAGTAGTTCCACTTGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-2132s21c1
Sequence:CCGGATCATGCGTACCCAGACTTTGCTCGAGCAAAGTCTGGGTACGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-2023s21c1
Sequence:CCGGTGGTTCAGTGACCACCGATATCTCGAGATATCGGTGGTCACTGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-1390s21c1
Sequence:CCGGGCCACGATGATCAACTCTTTCCTCGAGGAAAGAGTTGATCATCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-863s21c1
Sequence:CCGGTGCAGCATCCCAACGTGATTCCTCGAGGAATCACGTTGGGATGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-1096s21c1
Sequence:CCGGTCTGGGATCTCGGTGAGTAAACTCGAGTTTACTCACCGAGATCCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-2926s21c1
Sequence:CCGGGAGTCGAGCGTTGTGGATTACCTCGAGGTAATCCACAACGCTCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-1494s21c1
Sequence:CCGGGTTTGCCACCCAGCGCTTAAACTCGAGTTTAAGCGCTGGGTGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_014943.2-1259s1c1
Sequence:CCGGCCCACTAAATACTACCAAATACTCGAGTATTTGGTAGTATTTAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014943.2-519s1c1
Sequence:CCGGCGGACATCACAAGTAGTAGAACTCGAGTTCTACTACTTGTGATGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014943.2-2887s1c1
Sequence:CCGGCGATCTCAGATAGATCAGATACTCGAGTATCTGATCTATCTGAGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014943.2-701s1c1
Sequence:CCGGCCAAGGTGGTTATGAGTGCAACTCGAGTTGCACTCATAACCACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014943.2-2599s1c1
Sequence:CCGGCCGTAGCAAGGAAAGCAACAACTCGAGTTGTTGCTTTCCTTGCTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014943
VALIDATED
ZHX2 MISSION shRNA Lentiviral Transduction Particles
zinc fingers and homeoboxes 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-2738s21c1
Sequence:CCGGGTGATGTGGTTCCACAATATTCTCGAGAATATTGTGGAACCACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-740s21c1
Sequence:CCGGACGAAGTGATAGAGGTGAAATCTCGAGATTTCACCTCTATCACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014943.3-3359s21c1
Sequence:CCGGTGCTATACTGGAACCGATTTGCTCGAGCAAATCGGTTCCAGTATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014943.3-3184s21c1
Sequence:CCGGACTCCAAGTGGAACTACTTAGCTCGAGCTAAGTAGTTCCACTTGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-2132s21c1
Sequence:CCGGATCATGCGTACCCAGACTTTGCTCGAGCAAAGTCTGGGTACGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-2023s21c1
Sequence:CCGGTGGTTCAGTGACCACCGATATCTCGAGATATCGGTGGTCACTGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-1390s21c1
Sequence:CCGGGCCACGATGATCAACTCTTTCCTCGAGGAAAGAGTTGATCATCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-863s21c1
Sequence:CCGGTGCAGCATCCCAACGTGATTCCTCGAGGAATCACGTTGGGATGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-1096s21c1
Sequence:CCGGTCTGGGATCTCGGTGAGTAAACTCGAGTTTACTCACCGAGATCCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-2926s21c1
Sequence:CCGGGAGTCGAGCGTTGTGGATTACCTCGAGGTAATCCACAACGCTCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014943.3-1494s21c1
Sequence:CCGGGTTTGCCACCCAGCGCTTAAACTCGAGTTTAAGCGCTGGGTGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_014943.2-1259s1c1
Sequence:CCGGCCCACTAAATACTACCAAATACTCGAGTATTTGGTAGTATTTAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014943.2-519s1c1
Sequence:CCGGCGGACATCACAAGTAGTAGAACTCGAGTTCTACTACTTGTGATGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014943.2-2887s1c1
Sequence:CCGGCGATCTCAGATAGATCAGATACTCGAGTATCTGATCTATCTGAGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014943.2-701s1c1
Sequence:CCGGCCAAGGTGGTTATGAGTGCAACTCGAGTTGCACTCATAACCACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014943.2-2599s1c1
Sequence:CCGGCCGTAGCAAGGAAAGCAACAACTCGAGTTGTTGCTTTCCTTGCTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199449
ZHX2 MISSION shRNA Bacterial Glycerol Stock
zinc fingers and homeoboxes 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-950s1c1
Sequence:CCGGCGCAATAATCAGACGGTTCTACTCGAGTAGAACCGTCTGATTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-1297s1c1
Sequence:CCGGGCTGAATACTACCAAATACAACTCGAGTTGTATTTGGTAGTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-1450s1c1
Sequence:CCGGCCAGCGTTTAAAGCACGGTATCTCGAGATACCGTGCTTTAAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-2477s1c1
Sequence:CCGGCCTCAGGAGTACGATCAGTTACTCGAGTAACTGATCGTACTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-2101s1c1
Sequence:CCGGCCCGCAGAAGTTCAAAGAGAACTCGAGTTCTCTTTGAACTTCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199449
ZHX2 MISSION shRNA shRNA Plasmid DNA
zinc fingers and homeoboxes 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-950s1c1
Sequence:CCGGCGCAATAATCAGACGGTTCTACTCGAGTAGAACCGTCTGATTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-1297s1c1
Sequence:CCGGGCTGAATACTACCAAATACAACTCGAGTTGTATTTGGTAGTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-1450s1c1
Sequence:CCGGCCAGCGTTTAAAGCACGGTATCTCGAGATACCGTGCTTTAAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-2477s1c1
Sequence:CCGGCCTCAGGAGTACGATCAGTTACTCGAGTAACTGATCGTACTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-2101s1c1
Sequence:CCGGCCCGCAGAAGTTCAAAGAGAACTCGAGTTCTCTTTGAACTTCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199449
ZHX2 MISSION shRNA Lentiviral Transduction Particles
zinc fingers and homeoboxes 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-950s1c1
Sequence:CCGGCGCAATAATCAGACGGTTCTACTCGAGTAGAACCGTCTGATTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-1297s1c1
Sequence:CCGGGCTGAATACTACCAAATACAACTCGAGTTGTATTTGGTAGTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-1450s1c1
Sequence:CCGGCCAGCGTTTAAAGCACGGTATCTCGAGATACCGTGCTTTAAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-2477s1c1
Sequence:CCGGCCTCAGGAGTACGATCAGTTACTCGAGTAACTGATCGTACTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199449.1-2101s1c1
Sequence:CCGGCCCGCAGAAGTTCAAAGAGAACTCGAGTTCTCTTTGAACTTCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks