EMAIL THIS PAGE TO A FRIEND

ZHX3

zinc fingers and homeoboxes 3

Synonyms: TIX1
UniProtKB ID: Q9H4I2, E1P5W5, O43145
Gene ID:
Human(23051) Summary: This gene encodes a member of the zinc fingers and homeoboxes (ZHX) gene family. The encoded protein contains two C2H2-type zinc fingers and five homeodomains and forms a dimer with itself or with zinc fingers and homeoboxes family member 1. In the nucleus, the dimerized protein interacts with the A subunit of the ubiquitous transcription factor nuclear factor-Y and may function as a transcriptional repressor. [provided by RefSeq, Jul 2008]
Mouse(320799) zinc fingers and homeoboxes 3
Rat(311604) zinc fingers and homeoboxes 3
domestic guinea pig(100717263) zinc fingers and homeoboxes 3
naked mole-rat(101705800) zinc fingers and homeoboxes 3
Domestic Rabbit(100350204) zinc fingers and homeoboxes 3
cow(512451) zinc fingers and homeoboxes 3
sheep(101103586) zinc fingers and homeoboxes 3
Zebrafish(386659) zinc fingers and homeoboxes 3
dog(485875) zinc fingers and homeoboxes 3
chicken(419176) zinc fingers and homeoboxes 3
Horse(100070563) zinc fingers and homeoboxes 3
domestic cat(101092675) zinc fingers and homeoboxes 3
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177263 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177263 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177263 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015035 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015035 Rosetta Predictions human pricing
NM_001047097 Rosetta Predictions rat pricing
NM_177263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025747 predicted 1762
2 SASI_Hs01_00025748 predicted 579
3 SASI_Hs01_00025749 predicted 1747
4 SASI_Hs01_00025750 predicted 2520
5 SASI_Hs01_00025751 predicted 3133
6 SASI_Hs01_00025752 predicted 2942
7 SASI_Hs01_00025753 predicted 541
8 SASI_Hs01_00025754 predicted 2737
9 SASI_Hs01_00025755 predicted 2454
10 SASI_Hs01_00025756 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205904 predicted 853
2 SASI_Rn02_00205905 predicted 1342
3 SASI_Rn02_00205906 predicted 1074
4 SASI_Rn02_00205907 predicted 2532
5 SASI_Rn02_00205908 predicted 2836
6 SASI_Rn02_00205909 predicted 2449
7 SASI_Rn02_00205910 predicted 1285
8 SASI_Rn02_00205911 predicted 223
9 SASI_Rn02_00205912 predicted 2098
10 SASI_Rn02_00205913 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064778 predicted 2987
2 SASI_Mm01_00064779 predicted 3380
3 SASI_Mm01_00064780 predicted 883
4 SASI_Mm01_00064782 predicted 2069
5 SASI_Mm01_00064783 predicted 2806
6 SASI_Mm01_00064784 predicted 1732
7 SASI_Mm01_00064785 predicted 1889
8 SASI_Mm01_00064787 predicted 3310
9 SASI_Mm02_00347304 predicted 3218
10 SASI_Mm02_00347305 predicted 2881
11 SASI_Mm01_00064781 predicted 993
12 SASI_Mm01_00064786 predicted 2707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177263
ZHX3 MISSION shRNA Bacterial Glycerol Stock
zinc fingers and homeoboxes 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-2370s1c1
Sequence:CCGGCCGCCTAAGAAGTGAAACGAACTCGAGTTCGTTTCACTTCTTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-2910s1c1
Sequence:CCGGGCTCAAGTGGTACGAAGACTACTCGAGTAGTCTTCGTACCACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-714s1c1
Sequence:CCGGCCAGGATGTGACCCACTTTATCTCGAGATAAAGTGGGTCACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-1742s1c1
Sequence:CCGGCCAATGGGTTACAAGCATCAACTCGAGTTGATGCTTGTAACCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-2314s1c1
Sequence:CCGGCGAGTCCTAGAGAACAGCTTTCTCGAGAAAGCTGTTCTCTAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177263.3-960s21c1
Sequence:CCGGTACTACGGAAGGGACTGAAATCTCGAGATTTCAGTCCCTTCCGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177263.3-3589s21c1
Sequence:CCGGGAATCAAGTTGTTAGCATATACTCGAGTATATGCTAACAACTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177263.3-2062s21c1
Sequence:CCGGTGGTTCAGTGACCGGAGATATCTCGAGATATCTCCGGTCACTGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177263
ZHX3 MISSION shRNA shRNA Plasmid DNA
zinc fingers and homeoboxes 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-2370s1c1
Sequence:CCGGCCGCCTAAGAAGTGAAACGAACTCGAGTTCGTTTCACTTCTTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-2910s1c1
Sequence:CCGGGCTCAAGTGGTACGAAGACTACTCGAGTAGTCTTCGTACCACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-714s1c1
Sequence:CCGGCCAGGATGTGACCCACTTTATCTCGAGATAAAGTGGGTCACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-1742s1c1
Sequence:CCGGCCAATGGGTTACAAGCATCAACTCGAGTTGATGCTTGTAACCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-2314s1c1
Sequence:CCGGCGAGTCCTAGAGAACAGCTTTCTCGAGAAAGCTGTTCTCTAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177263.3-960s21c1
Sequence:CCGGTACTACGGAAGGGACTGAAATCTCGAGATTTCAGTCCCTTCCGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177263.3-3589s21c1
Sequence:CCGGGAATCAAGTTGTTAGCATATACTCGAGTATATGCTAACAACTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177263.3-2062s21c1
Sequence:CCGGTGGTTCAGTGACCGGAGATATCTCGAGATATCTCCGGTCACTGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177263
ZHX3 MISSION shRNA Lentiviral Transduction Particles
zinc fingers and homeoboxes 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-2370s1c1
Sequence:CCGGCCGCCTAAGAAGTGAAACGAACTCGAGTTCGTTTCACTTCTTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-2910s1c1
Sequence:CCGGGCTCAAGTGGTACGAAGACTACTCGAGTAGTCTTCGTACCACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-714s1c1
Sequence:CCGGCCAGGATGTGACCCACTTTATCTCGAGATAAAGTGGGTCACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-1742s1c1
Sequence:CCGGCCAATGGGTTACAAGCATCAACTCGAGTTGATGCTTGTAACCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177263.3-2314s1c1
Sequence:CCGGCGAGTCCTAGAGAACAGCTTTCTCGAGAAAGCTGTTCTCTAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177263.3-960s21c1
Sequence:CCGGTACTACGGAAGGGACTGAAATCTCGAGATTTCAGTCCCTTCCGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177263.3-3589s21c1
Sequence:CCGGGAATCAAGTTGTTAGCATATACTCGAGTATATGCTAACAACTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177263.3-2062s21c1
Sequence:CCGGTGGTTCAGTGACCGGAGATATCTCGAGATATCTCCGGTCACTGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015035
VALIDATED
ZHX3 MISSION shRNA Bacterial Glycerol Stock
zinc fingers and homeoboxes 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015035.2-1533s1c1
Sequence:CCGGGCCCACAATTACGGTTCTAAACTCGAGTTTAGAACCGTAATTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015035.2-2338s1c1
Sequence:CCGGCGAGAAATTGATAGCTGGTTTCTCGAGAAACCAGCTATCAATTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015035.2-2859s1c1
Sequence:CCGGCGAAGACTATAAGCGAGGCAACTCGAGTTGCCTCGCTTATAGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015035.2-624s1c1
Sequence:CCGGCGATTTCAGATCCCATGACATCTCGAGATGTCATGGGATCTGAAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015035.2-1943s1c1
Sequence:CCGGGCGAAGTTGAACATCTCACAACTCGAGTTGTGAGATGTTCAACTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015035.3-634s21c1
Sequence:CCGGTCCCATGACATGACCCAATTTCTCGAGAAATTGGGTCATGTCATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015035.3-586s21c1
Sequence:CCGGAGCACTTTAGATGGCTATTTACTCGAGTAAATAGCCATCTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015035.3-3521s21c1
Sequence:CCGGTCAGAGTTCATAGTCATATTCCTCGAGGAATATGACTATGAACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015035.3-1943s21c1
Sequence:CCGGGCGAAGTTGAACATCTCACAACTCGAGTTGTGAGATGTTCAACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015035.3-1533s21c1
Sequence:CCGGGCCCACAATTACGGTTCTAAACTCGAGTTTAGAACCGTAATTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015035
VALIDATED
ZHX3 MISSION shRNA shRNA Plasmid DNA
zinc fingers and homeoboxes 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015035.2-1533s1c1
Sequence:CCGGGCCCACAATTACGGTTCTAAACTCGAGTTTAGAACCGTAATTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015035.2-2338s1c1
Sequence:CCGGCGAGAAATTGATAGCTGGTTTCTCGAGAAACCAGCTATCAATTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015035.2-2859s1c1
Sequence:CCGGCGAAGACTATAAGCGAGGCAACTCGAGTTGCCTCGCTTATAGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015035.2-624s1c1
Sequence:CCGGCGATTTCAGATCCCATGACATCTCGAGATGTCATGGGATCTGAAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015035.2-1943s1c1
Sequence:CCGGGCGAAGTTGAACATCTCACAACTCGAGTTGTGAGATGTTCAACTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015035.3-634s21c1
Sequence:CCGGTCCCATGACATGACCCAATTTCTCGAGAAATTGGGTCATGTCATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015035.3-586s21c1
Sequence:CCGGAGCACTTTAGATGGCTATTTACTCGAGTAAATAGCCATCTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015035.3-3521s21c1
Sequence:CCGGTCAGAGTTCATAGTCATATTCCTCGAGGAATATGACTATGAACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015035.3-1943s21c1
Sequence:CCGGGCGAAGTTGAACATCTCACAACTCGAGTTGTGAGATGTTCAACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015035.3-1533s21c1
Sequence:CCGGGCCCACAATTACGGTTCTAAACTCGAGTTTAGAACCGTAATTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015035
VALIDATED
ZHX3 MISSION shRNA Lentiviral Transduction Particles
zinc fingers and homeoboxes 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015035.2-1533s1c1
Sequence:CCGGGCCCACAATTACGGTTCTAAACTCGAGTTTAGAACCGTAATTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015035.2-2338s1c1
Sequence:CCGGCGAGAAATTGATAGCTGGTTTCTCGAGAAACCAGCTATCAATTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015035.2-2859s1c1
Sequence:CCGGCGAAGACTATAAGCGAGGCAACTCGAGTTGCCTCGCTTATAGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015035.2-624s1c1
Sequence:CCGGCGATTTCAGATCCCATGACATCTCGAGATGTCATGGGATCTGAAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015035.2-1943s1c1
Sequence:CCGGGCGAAGTTGAACATCTCACAACTCGAGTTGTGAGATGTTCAACTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015035.3-634s21c1
Sequence:CCGGTCCCATGACATGACCCAATTTCTCGAGAAATTGGGTCATGTCATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015035.3-586s21c1
Sequence:CCGGAGCACTTTAGATGGCTATTTACTCGAGTAAATAGCCATCTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015035.3-3521s21c1
Sequence:CCGGTCAGAGTTCATAGTCATATTCCTCGAGGAATATGACTATGAACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015035.3-1943s21c1
Sequence:CCGGGCGAAGTTGAACATCTCACAACTCGAGTTGTGAGATGTTCAACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015035.3-1533s21c1
Sequence:CCGGGCCCACAATTACGGTTCTAAACTCGAGTTTAGAACCGTAATTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks